ID: 1118483206

View in Genome Browser
Species Human (GRCh38)
Location 14:66188282-66188304
Sequence CTAGATTGGGGAAGTTCTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118483201_1118483206 4 Left 1118483201 14:66188255-66188277 CCTGAATCTGAATGTTGGGCTGC No data
Right 1118483206 14:66188282-66188304 CTAGATTGGGGAAGTTCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118483206 Original CRISPR CTAGATTGGGGAAGTTCTCC TGG Intergenic