ID: 1118483207

View in Genome Browser
Species Human (GRCh38)
Location 14:66188297-66188319
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118483201_1118483207 19 Left 1118483201 14:66188255-66188277 CCTGAATCTGAATGTTGGGCTGC No data
Right 1118483207 14:66188297-66188319 TCTCCTGGATAATGTCCTGCAGG No data
1118483205_1118483207 -3 Left 1118483205 14:66188277-66188299 CCTTGCTAGATTGGGGAAGTTCT No data
Right 1118483207 14:66188297-66188319 TCTCCTGGATAATGTCCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118483207 Original CRISPR TCTCCTGGATAATGTCCTGC AGG Intergenic