ID: 1118483208

View in Genome Browser
Species Human (GRCh38)
Location 14:66188298-66188320
Sequence CTCCTGGATAATGTCCTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118483205_1118483208 -2 Left 1118483205 14:66188277-66188299 CCTTGCTAGATTGGGGAAGTTCT No data
Right 1118483208 14:66188298-66188320 CTCCTGGATAATGTCCTGCAGGG No data
1118483201_1118483208 20 Left 1118483201 14:66188255-66188277 CCTGAATCTGAATGTTGGGCTGC No data
Right 1118483208 14:66188298-66188320 CTCCTGGATAATGTCCTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118483208 Original CRISPR CTCCTGGATAATGTCCTGCA GGG Intergenic