ID: 1118483885

View in Genome Browser
Species Human (GRCh38)
Location 14:66195843-66195865
Sequence CCCCCCAGTGTGGCTGAGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118483882_1118483885 -6 Left 1118483882 14:66195826-66195848 CCTGAAGGTGGGAAAGTCCCCCC No data
Right 1118483885 14:66195843-66195865 CCCCCCAGTGTGGCTGAGTCTGG No data
1118483875_1118483885 27 Left 1118483875 14:66195793-66195815 CCATGGAGAGGGGACATGGAGGT No data
Right 1118483885 14:66195843-66195865 CCCCCCAGTGTGGCTGAGTCTGG No data
1118483881_1118483885 -2 Left 1118483881 14:66195822-66195844 CCTACCTGAAGGTGGGAAAGTCC No data
Right 1118483885 14:66195843-66195865 CCCCCCAGTGTGGCTGAGTCTGG No data
1118483880_1118483885 1 Left 1118483880 14:66195819-66195841 CCTCCTACCTGAAGGTGGGAAAG No data
Right 1118483885 14:66195843-66195865 CCCCCCAGTGTGGCTGAGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118483885 Original CRISPR CCCCCCAGTGTGGCTGAGTC TGG Intergenic
No off target data available for this crispr