ID: 1118488248

View in Genome Browser
Species Human (GRCh38)
Location 14:66234215-66234237
Sequence TCAGCTAAGCAGATTCAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118488248_1118488249 -1 Left 1118488248 14:66234215-66234237 CCAGCTTGAATCTGCTTAGCTGA No data
Right 1118488249 14:66234237-66234259 AGCCACCTCTCTGCTTCCTTAGG No data
1118488248_1118488252 14 Left 1118488248 14:66234215-66234237 CCAGCTTGAATCTGCTTAGCTGA No data
Right 1118488252 14:66234252-66234274 TCCTTAGGTAGCCAATTGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118488248 Original CRISPR TCAGCTAAGCAGATTCAAGC TGG (reversed) Intergenic
No off target data available for this crispr