ID: 1118488990

View in Genome Browser
Species Human (GRCh38)
Location 14:66241008-66241030
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118488987_1118488990 2 Left 1118488987 14:66240983-66241005 CCAATAAGTGTCCATTAAGCAAA No data
Right 1118488990 14:66241008-66241030 CCTTCTAACCCTGATTTTTGAGG No data
1118488988_1118488990 -9 Left 1118488988 14:66240994-66241016 CCATTAAGCAAAAACCTTCTAAC No data
Right 1118488990 14:66241008-66241030 CCTTCTAACCCTGATTTTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118488990 Original CRISPR CCTTCTAACCCTGATTTTTG AGG Intergenic
No off target data available for this crispr