ID: 1118493823

View in Genome Browser
Species Human (GRCh38)
Location 14:66288209-66288231
Sequence CTTTCAACACAGATGCAAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118493823_1118493831 30 Left 1118493823 14:66288209-66288231 CCCTTTTGCATCTGTGTTGAAAG No data
Right 1118493831 14:66288262-66288284 CGTGCTGGCCAGTGAGGCCCAGG No data
1118493823_1118493828 24 Left 1118493823 14:66288209-66288231 CCCTTTTGCATCTGTGTTGAAAG No data
Right 1118493828 14:66288256-66288278 CCCGGCCGTGCTGGCCAGTGAGG No data
1118493823_1118493826 15 Left 1118493823 14:66288209-66288231 CCCTTTTGCATCTGTGTTGAAAG No data
Right 1118493826 14:66288247-66288269 ATGTCTGCACCCGGCCGTGCTGG No data
1118493823_1118493825 6 Left 1118493823 14:66288209-66288231 CCCTTTTGCATCTGTGTTGAAAG No data
Right 1118493825 14:66288238-66288260 TTCAGAGCTATGTCTGCACCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118493823 Original CRISPR CTTTCAACACAGATGCAAAA GGG (reversed) Intergenic
No off target data available for this crispr