ID: 1118497052

View in Genome Browser
Species Human (GRCh38)
Location 14:66317038-66317060
Sequence TTCCAGGTATAGATGCTTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118497052_1118497057 16 Left 1118497052 14:66317038-66317060 CCATCAAGCATCTATACCTGGAA No data
Right 1118497057 14:66317077-66317099 GTGCCTGTAGACACTATGTCAGG No data
1118497052_1118497054 -6 Left 1118497052 14:66317038-66317060 CCATCAAGCATCTATACCTGGAA No data
Right 1118497054 14:66317055-66317077 CTGGAACCCAACACAACTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118497052 Original CRISPR TTCCAGGTATAGATGCTTGA TGG (reversed) Intergenic
No off target data available for this crispr