ID: 1118497362

View in Genome Browser
Species Human (GRCh38)
Location 14:66321518-66321540
Sequence TTTTTTACCTTCCACATATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118497362_1118497365 21 Left 1118497362 14:66321518-66321540 CCTCATATGTGGAAGGTAAAAAA No data
Right 1118497365 14:66321562-66321584 AGTAGAACAGTGGTTGCTGGAGG No data
1118497362_1118497364 18 Left 1118497362 14:66321518-66321540 CCTCATATGTGGAAGGTAAAAAA No data
Right 1118497364 14:66321559-66321581 GAGAGTAGAACAGTGGTTGCTGG No data
1118497362_1118497363 11 Left 1118497362 14:66321518-66321540 CCTCATATGTGGAAGGTAAAAAA No data
Right 1118497363 14:66321552-66321574 AGAATCAGAGAGTAGAACAGTGG No data
1118497362_1118497366 25 Left 1118497362 14:66321518-66321540 CCTCATATGTGGAAGGTAAAAAA No data
Right 1118497366 14:66321566-66321588 GAACAGTGGTTGCTGGAGGCTGG No data
1118497362_1118497368 30 Left 1118497362 14:66321518-66321540 CCTCATATGTGGAAGGTAAAAAA No data
Right 1118497368 14:66321571-66321593 GTGGTTGCTGGAGGCTGGGAAGG 0: 2
1: 16
2: 166
3: 852
4: 2989
1118497362_1118497367 26 Left 1118497362 14:66321518-66321540 CCTCATATGTGGAAGGTAAAAAA No data
Right 1118497367 14:66321567-66321589 AACAGTGGTTGCTGGAGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118497362 Original CRISPR TTTTTTACCTTCCACATATG AGG (reversed) Intergenic
No off target data available for this crispr