ID: 1118497366

View in Genome Browser
Species Human (GRCh38)
Location 14:66321566-66321588
Sequence GAACAGTGGTTGCTGGAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118497361_1118497366 26 Left 1118497361 14:66321517-66321539 CCCTCATATGTGGAAGGTAAAAA No data
Right 1118497366 14:66321566-66321588 GAACAGTGGTTGCTGGAGGCTGG No data
1118497362_1118497366 25 Left 1118497362 14:66321518-66321540 CCTCATATGTGGAAGGTAAAAAA No data
Right 1118497366 14:66321566-66321588 GAACAGTGGTTGCTGGAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118497366 Original CRISPR GAACAGTGGTTGCTGGAGGC TGG Intergenic
No off target data available for this crispr