ID: 1118497367

View in Genome Browser
Species Human (GRCh38)
Location 14:66321567-66321589
Sequence AACAGTGGTTGCTGGAGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118497362_1118497367 26 Left 1118497362 14:66321518-66321540 CCTCATATGTGGAAGGTAAAAAA No data
Right 1118497367 14:66321567-66321589 AACAGTGGTTGCTGGAGGCTGGG No data
1118497361_1118497367 27 Left 1118497361 14:66321517-66321539 CCCTCATATGTGGAAGGTAAAAA No data
Right 1118497367 14:66321567-66321589 AACAGTGGTTGCTGGAGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118497367 Original CRISPR AACAGTGGTTGCTGGAGGCT GGG Intergenic
No off target data available for this crispr