ID: 1118497470

View in Genome Browser
Species Human (GRCh38)
Location 14:66322554-66322576
Sequence TACCTGGCTTACCTTACACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118497470_1118497474 6 Left 1118497470 14:66322554-66322576 CCTGGTGTAAGGTAAGCCAGGTA No data
Right 1118497474 14:66322583-66322605 GAGCCACCAGAAGCTAAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118497470 Original CRISPR TACCTGGCTTACCTTACACC AGG (reversed) Intergenic
No off target data available for this crispr