ID: 1118501832

View in Genome Browser
Species Human (GRCh38)
Location 14:66369364-66369386
Sequence AGTTATCTGTGGATGATTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118501832_1118501834 2 Left 1118501832 14:66369364-66369386 CCTGCAATCATCCACAGATAACT No data
Right 1118501834 14:66369389-66369411 TCTCTTTTTGAGATAGCTCTTGG No data
1118501832_1118501835 13 Left 1118501832 14:66369364-66369386 CCTGCAATCATCCACAGATAACT No data
Right 1118501835 14:66369400-66369422 GATAGCTCTTGGCCTGCTACTGG No data
1118501832_1118501836 14 Left 1118501832 14:66369364-66369386 CCTGCAATCATCCACAGATAACT No data
Right 1118501836 14:66369401-66369423 ATAGCTCTTGGCCTGCTACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118501832 Original CRISPR AGTTATCTGTGGATGATTGC AGG (reversed) Intergenic
No off target data available for this crispr