ID: 1118502278

View in Genome Browser
Species Human (GRCh38)
Location 14:66372897-66372919
Sequence CTAGTTCACCAGTTTGCAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118502274_1118502278 26 Left 1118502274 14:66372848-66372870 CCCTGGTTCAGGGGCTTCAGACT No data
Right 1118502278 14:66372897-66372919 CTAGTTCACCAGTTTGCAGTTGG No data
1118502275_1118502278 25 Left 1118502275 14:66372849-66372871 CCTGGTTCAGGGGCTTCAGACTT No data
Right 1118502278 14:66372897-66372919 CTAGTTCACCAGTTTGCAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118502278 Original CRISPR CTAGTTCACCAGTTTGCAGT TGG Intergenic
No off target data available for this crispr