ID: 1118505399

View in Genome Browser
Species Human (GRCh38)
Location 14:66405385-66405407
Sequence CTCCTGTGTGGGGTCCACAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118505399_1118505405 5 Left 1118505399 14:66405385-66405407 CCTCTGTGGACCCCACACAGGAG No data
Right 1118505405 14:66405413-66405435 ATGCACATGTCTCCTTCGAAGGG No data
1118505399_1118505406 11 Left 1118505399 14:66405385-66405407 CCTCTGTGGACCCCACACAGGAG No data
Right 1118505406 14:66405419-66405441 ATGTCTCCTTCGAAGGGCTATGG No data
1118505399_1118505407 12 Left 1118505399 14:66405385-66405407 CCTCTGTGGACCCCACACAGGAG No data
Right 1118505407 14:66405420-66405442 TGTCTCCTTCGAAGGGCTATGGG No data
1118505399_1118505404 4 Left 1118505399 14:66405385-66405407 CCTCTGTGGACCCCACACAGGAG No data
Right 1118505404 14:66405412-66405434 CATGCACATGTCTCCTTCGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118505399 Original CRISPR CTCCTGTGTGGGGTCCACAG AGG (reversed) Intergenic
No off target data available for this crispr