ID: 1118505402

View in Genome Browser
Species Human (GRCh38)
Location 14:66405397-66405419
Sequence TGTGCATGCAGGCTCCTGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118505402_1118505404 -8 Left 1118505402 14:66405397-66405419 CCACACAGGAGCCTGCATGCACA No data
Right 1118505404 14:66405412-66405434 CATGCACATGTCTCCTTCGAAGG No data
1118505402_1118505407 0 Left 1118505402 14:66405397-66405419 CCACACAGGAGCCTGCATGCACA No data
Right 1118505407 14:66405420-66405442 TGTCTCCTTCGAAGGGCTATGGG No data
1118505402_1118505405 -7 Left 1118505402 14:66405397-66405419 CCACACAGGAGCCTGCATGCACA No data
Right 1118505405 14:66405413-66405435 ATGCACATGTCTCCTTCGAAGGG No data
1118505402_1118505409 27 Left 1118505402 14:66405397-66405419 CCACACAGGAGCCTGCATGCACA No data
Right 1118505409 14:66405447-66405469 ATACAGAACAGATCAGCAACAGG No data
1118505402_1118505406 -1 Left 1118505402 14:66405397-66405419 CCACACAGGAGCCTGCATGCACA No data
Right 1118505406 14:66405419-66405441 ATGTCTCCTTCGAAGGGCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118505402 Original CRISPR TGTGCATGCAGGCTCCTGTG TGG (reversed) Intergenic
No off target data available for this crispr