ID: 1118505406

View in Genome Browser
Species Human (GRCh38)
Location 14:66405419-66405441
Sequence ATGTCTCCTTCGAAGGGCTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118505400_1118505406 1 Left 1118505400 14:66405395-66405417 CCCCACACAGGAGCCTGCATGCA No data
Right 1118505406 14:66405419-66405441 ATGTCTCCTTCGAAGGGCTATGG No data
1118505399_1118505406 11 Left 1118505399 14:66405385-66405407 CCTCTGTGGACCCCACACAGGAG No data
Right 1118505406 14:66405419-66405441 ATGTCTCCTTCGAAGGGCTATGG No data
1118505401_1118505406 0 Left 1118505401 14:66405396-66405418 CCCACACAGGAGCCTGCATGCAC No data
Right 1118505406 14:66405419-66405441 ATGTCTCCTTCGAAGGGCTATGG No data
1118505402_1118505406 -1 Left 1118505402 14:66405397-66405419 CCACACAGGAGCCTGCATGCACA No data
Right 1118505406 14:66405419-66405441 ATGTCTCCTTCGAAGGGCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118505406 Original CRISPR ATGTCTCCTTCGAAGGGCTA TGG Intergenic
No off target data available for this crispr