ID: 1118514220

View in Genome Browser
Species Human (GRCh38)
Location 14:66508584-66508606
Sequence TCCTCCCCCGGTTACCTGTA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 74}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118514220_1118514227 19 Left 1118514220 14:66508584-66508606 CCTTACAGGTAACCGGGGGAGGA 0: 1
1: 0
2: 0
3: 13
4: 74
Right 1118514227 14:66508626-66508648 TGCTGTCCCTGCATTGCCTTAGG 0: 1
1: 0
2: 1
3: 19
4: 217
1118514220_1118514225 -5 Left 1118514220 14:66508584-66508606 CCTTACAGGTAACCGGGGGAGGA 0: 1
1: 0
2: 0
3: 13
4: 74
Right 1118514225 14:66508602-66508624 GAGGAGGTCTGGGACCTATGAGG 0: 1
1: 0
2: 1
3: 10
4: 187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118514220 Original CRISPR TCCTCCCCCGGTTACCTGTA AGG (reversed) Exonic
900596373 1:3481949-3481971 TCCTCTCCCGGTCACCTCCATGG + Intergenic
901303869 1:8218316-8218338 TCCTCCCCAGGCTACCTGTGGGG - Intergenic
903657669 1:24959131-24959153 GGCTCCCTCGGTTACCTGGAGGG - Intronic
907905477 1:58781112-58781134 TCCTCCCCCAGCTATCTATATGG - Exonic
908755478 1:67465558-67465580 TCCTGGCCTGGTTCCCTGTAAGG - Intergenic
910248953 1:85173354-85173376 TGCTCCCCCTGATACCTGCAGGG - Intronic
913697669 1:121343470-121343492 TCCTACCCAGGTTAGATGTAAGG + Intronic
914139890 1:144936581-144936603 TCCTCCCCAGGTTAGATGTAAGG - Intronic
914977798 1:152381537-152381559 TCCTCCCCCGGGATCCTGGAAGG - Intergenic
915904642 1:159868871-159868893 TCATGCCCAGGTTACCTGGAAGG - Intronic
920485058 1:206362120-206362142 TCCTCCCCAGGTTAGATGTAAGG + Intronic
923591159 1:235320814-235320836 TCCTCCCCCAGAAACCTGAATGG + Intronic
1064601149 10:16994649-16994671 TCGTCATCCGGTTACCTGTCTGG + Intronic
1066192847 10:33071682-33071704 TCCTTCCCTGGTCTCCTGTAGGG + Intergenic
1067058598 10:43066371-43066393 TCCTTCCCCGCTGACCAGTAAGG + Intergenic
1075548300 10:123372879-123372901 TCCTCTCCTTGTTCCCTGTAGGG - Intergenic
1078597815 11:12703519-12703541 TCCTCCCTCCTTTACCTGGAGGG + Intronic
1094452841 12:30600801-30600823 TCCTCCCCAGGTTGGCTGCAAGG - Intergenic
1101824565 12:108210113-108210135 TCCCCCAGGGGTTACCTGTATGG + Exonic
1101881632 12:108629780-108629802 TCCTCCCCCTTCTACCTGTGTGG - Intronic
1107223993 13:38024260-38024282 TCCTCCCTTGGTTACCTCTTTGG - Intergenic
1112089555 13:96068519-96068541 TACTCCCCCTGAAACCTGTAGGG - Intergenic
1118514220 14:66508584-66508606 TCCTCCCCCGGTTACCTGTAAGG - Exonic
1120410178 14:84144550-84144572 TTTTCTCCCAGTTACCTGTAAGG + Intergenic
1121003466 14:90470011-90470033 TCCTCCCCAGGTTACAAGTTTGG - Intergenic
1122720023 14:103716454-103716476 GCCTCCCCCGGTTCCCGGGAGGG - Intronic
1125009182 15:34852053-34852075 TCACCCTCTGGTTACCTGTAGGG + Exonic
1127326233 15:57897566-57897588 CCCTCCTCCCGTTACCTGCAAGG + Intergenic
1131364568 15:91827430-91827452 GGCTCCCCCGGTTACCTCTGGGG + Intergenic
1133168190 16:3963961-3963983 ACCTCCCCCCATTAGCTGTAAGG - Exonic
1134829033 16:17308465-17308487 TCCTCACCCAGCTCCCTGTAAGG + Intronic
1141155034 16:81591454-81591476 TCCTCCCCCAGATGCCAGTATGG - Intronic
1141255861 16:82401904-82401926 TCCTCCCCCAGATATCTGCAGGG - Intergenic
1145180128 17:20742136-20742158 TTCTCCCCGTGTTACCTCTAAGG - Intergenic
1149839842 17:59951843-59951865 TTCTCCCCTTGTTACCTCTAAGG - Intronic
1150528640 17:65953692-65953714 TACTTCCCTGGTGACCTGTATGG + Intronic
1163441381 19:17324070-17324092 TCCTCCCCCTGTGACCGGCAGGG - Intronic
1168147141 19:54426158-54426180 TGCTCCCCACGTTACATGTAGGG + Intronic
930690257 2:54355453-54355475 TCCTGCCCCTGCTACCTGTTTGG + Intronic
933161235 2:79026873-79026895 TCCTCCCCCTGAGACCTGCATGG - Intronic
940117760 2:150227893-150227915 ACCTCCCCTGGTTACCTGACAGG - Intergenic
946027678 2:216681662-216681684 TCCTCCTCTGGCTACCTGTTGGG + Intronic
1170112719 20:12822918-12822940 CCCTCCCCCAGTTACCTGCATGG - Intergenic
1170304104 20:14918413-14918435 CCCTCCTCCGGTTGCCTGGATGG - Intronic
1173512810 20:43643637-43643659 TCCTCCCCCAGATATCTGCATGG - Intronic
1176424678 21:6540911-6540933 TCCTTCCCTGCTTTCCTGTAAGG + Intergenic
1179700167 21:43149220-43149242 TCCTTCCCTGCTTTCCTGTAAGG + Intergenic
1182388312 22:29966698-29966720 TCTTCCACTGGTGACCTGTAGGG + Intronic
950216311 3:11162228-11162250 TCCTCCCCTGGTTCCTTGCATGG - Intronic
955384359 3:58467291-58467313 TCCTCCCCTGCTTCCCTCTAGGG + Intergenic
955821441 3:62900108-62900130 TCCTCACCCAGTTTCTTGTATGG + Intergenic
962293813 3:134161957-134161979 TGCTTCCCCGGAAACCTGTAGGG + Intronic
963093088 3:141504951-141504973 TCCTTCCCCAGATATCTGTATGG + Intronic
976789053 4:88856755-88856777 TCCTCCACCTGTCACTTGTATGG + Intronic
982092338 4:151891500-151891522 TCCTCACCCGGACACCTGGAGGG - Intergenic
983365750 4:166786189-166786211 TCTTCCCCCAGGTATCTGTATGG - Intronic
983819345 4:172173323-172173345 TCCTCCCCCAGTTCCCTGCCAGG - Intronic
989702666 5:44289025-44289047 TCTTCCCCAGGATATCTGTATGG - Intergenic
993628923 5:90260073-90260095 CCCTCCCCATGTTCCCTGTAGGG - Intergenic
999105710 5:149069103-149069125 TACTCCCCCTGAAACCTGTAGGG - Intergenic
999697987 5:154203133-154203155 TCCTCCCTCTGTGACTTGTATGG + Intronic
1000350639 5:160349749-160349771 GCTTTCCCCGGTTACCTGTCCGG + Exonic
1001116123 5:168941633-168941655 TCCTCCTTCAGTTACCTGAAAGG - Intronic
1003569580 6:7247214-7247236 GCCTGCCCTGGTTACCTGTGTGG - Exonic
1004745077 6:18501581-18501603 TCCATCCCAGGTTACCTCTACGG + Intergenic
1007379484 6:41478433-41478455 TCTTCCCCCGGTTATCTGCAGGG + Intergenic
1016175746 6:141075796-141075818 TTCTCCCCAGGTTAGCTCTAGGG + Intergenic
1019531615 7:1506331-1506353 TCCTCCTCCTGTCACCTGAATGG + Intergenic
1023840996 7:44097353-44097375 TCCTCCCCCGCTTCCCTGGTGGG - Intergenic
1023937590 7:44750346-44750368 TCCTGCCCCCTCTACCTGTAAGG - Intronic
1027226694 7:76248180-76248202 TCCTCCTCCGAATACCTGCAGGG - Exonic
1030206933 7:106960159-106960181 CCTTTCCCCAGTTACCTGTAAGG + Intergenic
1033941252 7:146657431-146657453 TCCTCCACCAGGTACCTGAAGGG - Intronic
1034123531 7:148650426-148650448 TCCACTCCCTGTTCCCTGTAAGG + Intergenic
1038712772 8:29963261-29963283 TCATCCCCCTGGTATCTGTAGGG - Intergenic
1048293950 8:133200589-133200611 TCCTCCTCCAGCTACCTCTAAGG - Intronic
1049977003 9:869588-869610 TCCTATCTCGGTTACTTGTAAGG + Intronic
1050163203 9:2739144-2739166 TCTTCCCCAGGATACCTGTGGGG - Intronic
1053138086 9:35664357-35664379 TCATCTCCAGGTTACCTGCAGGG + Exonic
1203760703 EBV:12130-12152 TCCTCCCCCGGTCCCCAGTAGGG + Intergenic
1203761632 EBV:15202-15224 TCCTCCCCCGGTCCCCAGTAGGG + Intergenic
1203762561 EBV:18274-18296 TCCTCCCCCGGTCCCCAGTAGGG + Intergenic
1203763490 EBV:21346-21368 TCCTCCCCCGGTCCCCAGTAGGG + Intergenic
1203764419 EBV:24418-24440 TCCTCCCCCGGTCCCCAGTAGGG + Intergenic
1203765348 EBV:27490-27512 TCCTCCCCCGGTCCCCAGTAGGG + Intergenic
1203766277 EBV:30562-30584 TCCTCCCCCGGTCCCCAGTAGGG + Intergenic
1203767206 EBV:33634-33656 TCCTCCCCCGGTCCCCAGTAGGG + Intergenic
1190234230 X:48603720-48603742 ACCCCCCCAGGTTACCTGTGGGG + Intronic