ID: 1118517341

View in Genome Browser
Species Human (GRCh38)
Location 14:66544975-66544997
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2339
Summary {0: 1, 1: 8, 2: 43, 3: 415, 4: 1872}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118517341 Original CRISPR GTGTAGTAGGAGGTAGACAC AGG (reversed) Intronic
Too many off-targets to display for this crispr