ID: 1118520218

View in Genome Browser
Species Human (GRCh38)
Location 14:66575227-66575249
Sequence TGAAAAATGCTGAAAGTGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 464
Summary {0: 1, 1: 0, 2: 2, 3: 38, 4: 423}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118520218_1118520219 8 Left 1118520218 14:66575227-66575249 CCTCTCACTTTCAGCATTTTTCA 0: 1
1: 0
2: 2
3: 38
4: 423
Right 1118520219 14:66575258-66575280 ACATGCTCTCCTAGCCTGCGAGG 0: 1
1: 0
2: 0
3: 7
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118520218 Original CRISPR TGAAAAATGCTGAAAGTGAG AGG (reversed) Intronic
901136131 1:6997497-6997519 TGTAAAAACCTGAAATTGAGAGG - Intronic
901314667 1:8298204-8298226 TGAAAGAAGCAGAAAGTGTGTGG + Intergenic
902033966 1:13443046-13443068 TGCAAAATGTTGCAGGTGAGAGG + Intergenic
902831666 1:19017870-19017892 TCAAAAATGCTGAGAAGGAGAGG + Intergenic
903537662 1:24077615-24077637 TGATAAATGCTGCAATTGAGGGG - Intronic
904220839 1:28967573-28967595 AGAAAACTGCTGAAAATGAAGGG - Intronic
904957625 1:34298357-34298379 TGGAAAAGGATGAGAGTGAGAGG - Intergenic
905949348 1:41934935-41934957 TGAACAATTCTGAAATTAAGTGG - Intronic
906456765 1:46003895-46003917 TGAAGAATGCTGCAAGTAATGGG - Intronic
907000881 1:50854435-50854457 TGAAAAATGGTAACAGTCAGAGG + Intronic
907250547 1:53135413-53135435 TCGAAAATGCTGAGAGAGAGAGG + Intronic
907340847 1:53735231-53735253 TTTAAAATGCTGAATGTGAAGGG - Intergenic
907486162 1:54779749-54779771 TGAAGAATGGTGAAAGTTTGTGG + Exonic
907947665 1:59150589-59150611 TGAAGAAGGCTGAAAGGGTGTGG - Intergenic
909606242 1:77511498-77511520 TTAAAAATGTTAAGAGTGAGAGG + Intronic
910524403 1:88161329-88161351 TGGGAAATGCTGAAAGGGACTGG + Intergenic
910666322 1:89728958-89728980 TGACACAACCTGAAAGTGAGAGG + Intronic
910669037 1:89754632-89754654 TGAAAAATGCTGCAAGAAAGAGG - Intronic
910680105 1:89854224-89854246 TGAAATCTGCTGAGAGTGTGGGG + Intronic
911126418 1:94344841-94344863 GGAAAAATGCTAAAGGTAAGAGG + Intergenic
911227847 1:95326630-95326652 TGAAAAATGGTGGAAAAGAGCGG + Intergenic
911584477 1:99674789-99674811 TGAACAATCCAGAAAGTGGGAGG + Intronic
911978920 1:104541226-104541248 TGATGCATGATGAAAGTGAGGGG - Intergenic
912664721 1:111568697-111568719 TGAAAAAATCTGCATGTGAGTGG - Intronic
914453507 1:147814296-147814318 TCAAAACTTCTGAAAATGAGTGG + Intergenic
914867671 1:151445796-151445818 TTATAGATGCTGAAAGTGAAAGG - Intronic
915047239 1:153028552-153028574 TGACAAATGATGATAGTGAGGGG - Intergenic
915160729 1:153918363-153918385 TCAAACTTGCTGAAAGAGAGGGG - Intronic
915750892 1:158209548-158209570 TGAAGAAGGTAGAAAGTGAGAGG + Intergenic
916273372 1:162967934-162967956 AGAAAAATCCAGAGAGTGAGGGG + Intergenic
916798701 1:168192921-168192943 TGACAAATGCTATAATTGAGAGG - Intronic
917514919 1:175699242-175699264 AAAAAAATGGTGAAAGGGAGAGG + Intronic
917558568 1:176118807-176118829 TGATAAATGCTCAAGGTGATGGG + Intronic
918119778 1:181528590-181528612 ACAAAAATGCTGATAGTGATAGG + Intronic
918456966 1:184730985-184731007 CAAAAAATGCTGAAAGTTAAGGG + Intronic
920601657 1:207331249-207331271 TGAATAATGATGAAGGAGAGTGG + Exonic
920722166 1:208398009-208398031 TGAAAAATGCAAAAACTGAATGG + Intergenic
921110202 1:212028754-212028776 TGCAAAGTGCTTAAAGTGACTGG - Intronic
921164858 1:212499677-212499699 TGCTAGATGCTGAAAGCGAGAGG + Intergenic
921210752 1:212894972-212894994 TGATTAATGCTGAAACAGAGGGG - Exonic
921734225 1:218608619-218608641 TGAGAGAGGCTGAATGTGAGTGG + Intergenic
922247176 1:223812232-223812254 TGAGAAATGCTGATACTTAGGGG - Intronic
922595620 1:226810662-226810684 TGAGAAATGCAGAATGTGATGGG + Intergenic
923753641 1:236770468-236770490 AGAAAGAAGCAGAAAGTGAGAGG - Intergenic
923929561 1:238679100-238679122 TGTAAAAATCTGAAAGTAAGAGG - Intergenic
924556162 1:245120619-245120641 TGAAAAATGCTGAAAATAAAAGG - Intronic
924793180 1:247271903-247271925 TCCAAAATGCTGATAGTGATAGG - Intergenic
1063428899 10:5971560-5971582 TGAAAGGTGCTGTAAGCGAGGGG - Intronic
1063511324 10:6647564-6647586 TAAAGAATGCTGAAAGATAGAGG + Intergenic
1063829733 10:9938552-9938574 TGGAAAAAGAAGAAAGTGAGAGG - Intergenic
1064133583 10:12731431-12731453 AGAAAAGTCATGAAAGTGAGCGG + Intronic
1064504437 10:16013659-16013681 TTAAAGATGCTGAAATGGAGAGG - Intergenic
1065579034 10:27153295-27153317 TTAAAAATTCTTAAAATGAGGGG + Intronic
1065625801 10:27627151-27627173 TGGAAAGTACAGAAAGTGAGAGG + Intergenic
1066499451 10:35975726-35975748 TGAACAATACTGAGAGTGAAAGG - Intergenic
1067704443 10:48596535-48596557 AGGAAGATGCAGAAAGTGAGAGG + Intronic
1068228495 10:54138099-54138121 TAAAAAATTCTCAAACTGAGAGG - Intronic
1069143214 10:64854709-64854731 TGAAAAATGCTGAGACTGGATGG + Intergenic
1069358430 10:67614303-67614325 TGAATCATCCTGAAACTGAGAGG - Intronic
1069740767 10:70685785-70685807 TGATTAATGCTAAAAGTGATTGG + Intronic
1070091875 10:73294935-73294957 TGAAAATTGAGGAAAGAGAGGGG - Intronic
1071080983 10:81810733-81810755 AGTAGAATGCTGAAAATGAGTGG - Intergenic
1071089112 10:81898195-81898217 AGAAAAAGGAAGAAAGTGAGGGG + Intronic
1071283399 10:84123554-84123576 AGAAAAAGGCAGAAAGAGAGAGG - Intergenic
1072894442 10:99354605-99354627 TGATAAATGCTGTAATAGAGAGG + Intronic
1073251927 10:102125552-102125574 TGAAAAATACTAAAAGTGGCTGG - Intergenic
1073692941 10:105831598-105831620 TTAAAATGGCAGAAAGTGAGGGG + Intergenic
1074637150 10:115332766-115332788 TCAGAAAATCTGAAAGTGAGAGG - Intronic
1074960396 10:118439968-118439990 TTAAAAATGGAGGAAGTGAGAGG - Intergenic
1075024352 10:118973300-118973322 AGAAAAATACAGAAAATGAGGGG + Intergenic
1075303905 10:121350558-121350580 TGAAAGATACAGAGAGTGAGGGG - Intergenic
1077095468 11:797261-797283 TGGAGAATGATGACAGTGAGGGG + Intronic
1078205997 11:9229810-9229832 TGAAGAATGAAGAAAGGGAGAGG - Intronic
1078258465 11:9681907-9681929 TGAAAAGTGTTGAGAGAGAGAGG + Intronic
1078520374 11:12058034-12058056 TGACAAACGCTGAAACTTAGTGG + Intergenic
1078586027 11:12589913-12589935 AGAAAAATTATGAAAATGAGAGG + Intergenic
1078690633 11:13576710-13576732 GGAAAAATGTTGAATGTGAAGGG + Intergenic
1079345298 11:19646537-19646559 TGAAAACTACTGGAAGTCAGAGG + Intronic
1079551581 11:21705491-21705513 TTAAAAATGGTGAAAGAGATTGG + Intergenic
1079845763 11:25465477-25465499 ACACAAATGCTGAAAGTGAAAGG + Intergenic
1080322337 11:31025999-31026021 TGTAAAATGCAGAAAGTGCCAGG + Intronic
1080546777 11:33327427-33327449 TGAAAAAGACTGAAAGAGATAGG + Intronic
1080835876 11:35940682-35940704 TGAATTATCCTGAAAGTCAGTGG + Intergenic
1081329175 11:41783264-41783286 ACTAAAATGCTGAAAGAGAGAGG - Intergenic
1081476852 11:43441799-43441821 TTAAAAATTCTGAGAGAGAGGGG - Intronic
1081495320 11:43603583-43603605 AGAAAAATGTTGTAAGTGATGGG + Intronic
1083107922 11:60376402-60376424 TGTAAAATGCTGAAGTTGGGGGG + Intronic
1083206156 11:61150524-61150546 TGAAAAAGGTTGAAAGTGACAGG - Intronic
1084343470 11:68525977-68525999 TGAAAAATGGTGAAACTGCTTGG - Intronic
1085940334 11:81199978-81200000 TGCAAACAGCTGAAAGTGGGTGG + Intergenic
1087538846 11:99488854-99488876 TGAAAGATACTGAAAAAGAGGGG + Intronic
1090819524 11:130328672-130328694 AGAAAAATGATCAAAGTGTGTGG - Intergenic
1092794999 12:12101568-12101590 TGATAAAGGATGAAAGAGAGAGG + Intronic
1093002724 12:14016177-14016199 GGAAAGCTTCTGAAAGTGAGGGG - Intergenic
1094094222 12:26685760-26685782 TGAAAAATGTTGAAATTTACTGG - Intronic
1094319147 12:29166649-29166671 TGAAAACTGATGAAAGTGTGAGG - Intronic
1094780434 12:33786212-33786234 TGATAAATGTTTAAAGTGATAGG - Intergenic
1095375248 12:41519649-41519671 GGAAAAATGAGGAACGTGAGGGG + Intronic
1097643419 12:62208161-62208183 TGAAAAATTCTGAAAATAGGAGG + Intronic
1098010200 12:66043006-66043028 TGAAAAATGATAAAAATGTGAGG - Intergenic
1098083047 12:66810073-66810095 TGAATAATTCTGAATTTGAGAGG + Intergenic
1098936830 12:76490188-76490210 TGAACACTGCTGAAATTGACAGG + Intronic
1100940648 12:99719892-99719914 GGAGAAAAACTGAAAGTGAGGGG - Intronic
1103232005 12:119339235-119339257 TGGAAAAGGCTGAAAAAGAGAGG + Intronic
1103646361 12:122396445-122396467 TTAAAAATTCTGAAATTGAAGGG + Intronic
1103709073 12:122897509-122897531 AGAAAAATGATGAAAGTTAGAGG + Intergenic
1103816997 12:123666338-123666360 TGTCCAATGCTGAAAGTGGGAGG + Intergenic
1104111172 12:125706077-125706099 TGAAAATTGCTGAAGACGAGTGG + Intergenic
1104115844 12:125748351-125748373 ACAAAAATGCTGATAGTGATAGG + Intergenic
1104248988 12:127071725-127071747 AGCAAAATGCTGCAAGTGATTGG - Intergenic
1104407467 12:128530089-128530111 TGAAAAAGGCAGAAAGTGGGCGG + Intronic
1104533292 12:129593513-129593535 TTAAATGTGCTGAAAGTGGGTGG + Intronic
1105770261 13:23603960-23603982 TGTATGATGCTGAAAATGAGTGG - Intronic
1106016713 13:25876208-25876230 TGGAAGAGGCTGAAAGTGAAGGG + Intronic
1107083648 13:36402561-36402583 TGTCCAATGCTGAAAGTCAGGGG + Intergenic
1107427422 13:40307769-40307791 TGGAAAATGTGGAAAGGGAGAGG + Intergenic
1108026099 13:46179676-46179698 TGAAAAAAGGTGAAAGAGAATGG + Intronic
1108780371 13:53823394-53823416 TGAAAAATGCTGAAAAATACAGG + Intergenic
1108923670 13:55709420-55709442 GGAAAAATGATCAGAGTGAGTGG - Intergenic
1109093416 13:58078412-58078434 TCAAAAAGGCTGAAATTAAGAGG - Intergenic
1109336010 13:60994799-60994821 AGAAAAATGCGAAAAGAGAGTGG - Intergenic
1109470344 13:62796277-62796299 TAAAAGATGCTGAAAATGAATGG + Intergenic
1109923448 13:69102025-69102047 AGAAAAAAGTTGGAAGTGAGGGG + Intergenic
1111618199 13:90689270-90689292 AAAAAGATGCTGCAAGTGAGTGG + Intergenic
1111671038 13:91330683-91330705 TTAAAAATGAGGAAATTGAGAGG + Intergenic
1112646563 13:101339661-101339683 TGAAAGGCGCTGAAAGGGAGAGG + Intronic
1112748411 13:102553629-102553651 TGAAAAAGGCTCACAGAGAGAGG - Intergenic
1112795207 13:103049318-103049340 TGGAAAATGCTGTAGATGAGCGG + Exonic
1112895451 13:104294119-104294141 TGACAAACGCTGAAAGAGAAAGG - Intergenic
1114858741 14:26488788-26488810 TCAAAAATGGTGATATTGAGGGG - Intronic
1114885477 14:26844391-26844413 TGATAAATGAGGAAAGAGAGAGG - Intergenic
1114932851 14:27495403-27495425 TGATACATGGTGAAAGTTAGAGG - Intergenic
1115118613 14:29912413-29912435 TGAAAAATAATGCAAGTCAGGGG - Intronic
1115843437 14:37498480-37498502 ACAAGAATGCAGAAAGTGAGAGG + Intronic
1115878055 14:37882685-37882707 TTAATAATGAGGAAAGTGAGGGG - Intronic
1116461266 14:45177786-45177808 TACAAAATGATGAAAGCGAGGGG + Intronic
1117117171 14:52526159-52526181 TGAAAAGTGGTAAAATTGAGTGG - Intronic
1117732439 14:58736878-58736900 GGAACAATGATGAAAGTTAGGGG + Intergenic
1118240141 14:64048058-64048080 TGAAAAACACTGAAGATGAGCGG + Exonic
1118520218 14:66575227-66575249 TGAAAAATGCTGAAAGTGAGAGG - Intronic
1119976307 14:79028133-79028155 TGAGGTATGCTGAAAGTTAGTGG + Intronic
1120051694 14:79874650-79874672 GGAAATATGCTAAGAGTGAGGGG + Intergenic
1120365209 14:83560340-83560362 TGGAAAATGCTTCAAGAGAGCGG + Intergenic
1120365847 14:83568043-83568065 AGAAAAATTCTGAAGGTAAGTGG + Intergenic
1120471356 14:84929002-84929024 TGTAAAATGATGAAAATAAGTGG - Intergenic
1120711161 14:87794425-87794447 TTAAAAGTGCTGAAAATGTGCGG - Intergenic
1121266783 14:92608833-92608855 TTAAAAATGCTAAGAGAGAGAGG - Intronic
1121896545 14:97653480-97653502 TGAAAGATCCTGAACGTCAGGGG - Intergenic
1122078161 14:99248717-99248739 TGAAAAATGAGGAAAGTTGGGGG + Intronic
1123922923 15:25083220-25083242 TGAACAATGATGAAAATGAGTGG - Intergenic
1124580365 15:30948507-30948529 AGAAAAATGCTGAGAGAGAAAGG + Intronic
1124783482 15:32657991-32658013 TGGAACATGCTGTAAGGGAGTGG - Intronic
1127542826 15:59959401-59959423 TGAAAGAAGCTGAAAGTTAGGGG - Intergenic
1129935961 15:79450482-79450504 TGAAAAGTTCTGAAAGCCAGAGG - Intronic
1129937441 15:79462637-79462659 TGCAAAATGGTGAAAGAAAGAGG + Intronic
1131643673 15:94319094-94319116 TAAAAAATGTTGAAAGAGTGGGG - Intronic
1132343070 15:101090182-101090204 TGAAAAAGGCAGAAATGGAGGGG + Intergenic
1133584295 16:7177371-7177393 TGATAAATGCTGGAGGTGATGGG + Intronic
1134149408 16:11794489-11794511 TGAAAATTACTTAAAGTGTGAGG - Intronic
1134317954 16:13137082-13137104 TGAAAACTCCTGAAAGGGAAAGG - Intronic
1134387285 16:13785578-13785600 AAAAAAATGCTAAAAGTCAGAGG + Intergenic
1135270203 16:21062813-21062835 TGAAAAGTGATAAAAGAGAGTGG - Intronic
1135574429 16:23574551-23574573 TGCAAAATGGTGAAAGTGACCGG + Intergenic
1137264214 16:46855415-46855437 AGTAAACTGATGAAAGTGAGTGG - Intergenic
1137910884 16:52376899-52376921 AGAGAAATGCTGAAAGTCCGGGG - Intergenic
1137917962 16:52453733-52453755 TGAAAAATGCTCTAGGTGTGGGG - Intronic
1138523892 16:57590663-57590685 TGAAAAATGATGAAACAGCGTGG + Intronic
1138694783 16:58802921-58802943 TGACACATGCTGAAACTGACAGG - Intergenic
1139498898 16:67344231-67344253 TGACAACTGGTAAAAGTGAGAGG + Intronic
1140318941 16:73928902-73928924 TGAAAACAGCTGAAATTTAGGGG + Intergenic
1140614648 16:76647344-76647366 TGAAAAAAGATGAAAGTAAATGG - Intergenic
1140732526 16:77869684-77869706 TGGAAAATGCTCGAAGTGGGTGG - Intronic
1141313376 16:82936572-82936594 TTAAAAATGCTGAAGGTGGGGGG - Intronic
1142871323 17:2823063-2823085 TGAAAAATGCTGTAAATGGGTGG + Intronic
1143214626 17:5215200-5215222 TGGAAATGGCTGAAAATGAGGGG + Intronic
1143350003 17:6280901-6280923 TGCAAGATTCTGAAACTGAGAGG - Intergenic
1144162652 17:12576905-12576927 TGACAGATTCTGAGAGTGAGTGG - Intergenic
1144493510 17:15733394-15733416 TGTAAAATGCTGGGTGTGAGTGG - Intronic
1144906752 17:18643258-18643280 TGTAAAATGCTGGGTGTGAGTGG + Intronic
1146655774 17:34634173-34634195 CAAAAAATGCTAAAATTGAGAGG - Intronic
1146670201 17:34732153-34732175 TGAAAAATCCTGAAGCAGAGTGG - Intergenic
1148769952 17:50060927-50060949 TGGAGAATCCTGAAGGTGAGAGG - Intronic
1149310120 17:55385297-55385319 TGGAAAATGCTGAGGGTGTGCGG - Intergenic
1150183485 17:63153691-63153713 TGAACAATGCTGAAAGTCTTTGG + Intronic
1150729640 17:67680933-67680955 TGAAGGAGGCTGAAAGTGAACGG + Intronic
1155124300 18:22856257-22856279 TTAAAAATGCTGAAAGGGGGAGG + Intronic
1155203688 18:23538734-23538756 TTTAAAATACTGACAGTGAGGGG + Intronic
1158683175 18:59587668-59587690 AGAAAAATGCTGAATAGGAGTGG - Intronic
1158725106 18:59964231-59964253 TAAAAAATGCTGAAAGGGTATGG + Intergenic
1159361819 18:67414982-67415004 TGAAAAATGGTGAAGGGGGGTGG - Intergenic
1164124918 19:22304422-22304444 TGGAAATTGCTGAAATTGAGTGG + Intronic
1164903115 19:31945082-31945104 TGAAAAAAGCAGAAAGAGAGAGG + Intergenic
1166442942 19:42831990-42832012 TGTCAAATCCTGAAAGTGAATGG + Intronic
1166462627 19:43002752-43002774 TGTCAAATCCTGAAAGTGAATGG + Intronic
1166468765 19:43059213-43059235 TGTCAAATCCTGAAAGTGAATGG + Intronic
1167824680 19:51961405-51961427 GGAAAAATGCAGAAAATGGGGGG + Intergenic
1168221079 19:54960986-54961008 TTAAAAATGCTAGAACTGAGTGG + Intronic
925247824 2:2400492-2400514 TGAACAATGCAGAAGGTGCGAGG - Intergenic
925487395 2:4350768-4350790 TGGCAAATGTTAAAAGTGAGGGG + Intergenic
925891418 2:8438081-8438103 TGAAAAATGCTGCAAGGCAGGGG + Intergenic
926164227 2:10508625-10508647 TGAAAAATGGTGTTAGTTAGAGG - Intergenic
928817207 2:35312233-35312255 TGAAAAAAGATGAAATTGATGGG + Intergenic
929099728 2:38300177-38300199 AGAGAAATGCTGAAAATGGGGGG - Intronic
930205159 2:48580381-48580403 AGACATATGCTGAAAGTGAAAGG - Intronic
930263325 2:49171733-49171755 TGCAAAATGCTGAGAAGGAGAGG + Intergenic
930493594 2:52108685-52108707 TGATAAAGGCTCCAAGTGAGTGG - Intergenic
931175437 2:59849896-59849918 TGAAAAATTCTTACAGTCAGTGG - Intergenic
931807052 2:65817653-65817675 TGAAAAGGGCAGAAAGGGAGTGG + Intergenic
933176510 2:79179638-79179660 TGAAAAAAGCTGAAACTGGCTGG - Intergenic
934114955 2:88779305-88779327 TTAAAAATGAAGAAAGTAAGTGG + Intergenic
934162077 2:89259104-89259126 TGAAAAACGATGAATGTGAACGG - Intergenic
934205205 2:89923258-89923280 TGAAAAACGATGAATGTGAACGG + Intergenic
934631698 2:95932700-95932722 TCAAAAATGAAGAAAGTAAGTGG - Intronic
934801948 2:97171984-97172006 TCAAAAATGAAGAAAGTAAGTGG + Intronic
935481363 2:103594169-103594191 ACAAAAATGCTGATAGTGACAGG + Intergenic
936096891 2:109537075-109537097 AGTAAAATGCTGAATGTAAGGGG + Intergenic
936812625 2:116420322-116420344 TGAAATAGGCTTAAAATGAGGGG - Intergenic
938563362 2:132494727-132494749 TAAAAAAAGCTCAAAGTTAGTGG - Intronic
939327529 2:140712979-140713001 TGAAGAATGCTTATAGTTAGGGG - Intronic
939705578 2:145448397-145448419 TGACTAATGCTGATAGTTAGAGG + Intergenic
940166493 2:150779493-150779515 TGAAAAATGTTAAAAATGTGTGG - Intergenic
940184481 2:150968366-150968388 TGAAAAGTGATAAAAATGAGGGG + Intergenic
940551772 2:155167823-155167845 TCAAAAATGCTGGAGGTGAAGGG - Intergenic
941165120 2:162075577-162075599 AGCAAAATGCTGAGAGTGAAGGG - Intergenic
941784691 2:169484526-169484548 TTCAAACTGCTGAAAGGGAGGGG - Intronic
942703730 2:178744389-178744411 TAAAAAATTCTGAAAATGAAGGG - Intronic
943168477 2:184363996-184364018 TTAAAAGGGCTGAAATTGAGAGG - Intergenic
944317140 2:198295361-198295383 TTAAAAATCCTGAAAGTCAAAGG - Intronic
945185721 2:207137465-207137487 TGTAAAATTCTTAAAGGGAGTGG - Intronic
946587031 2:221201229-221201251 TTGAGAATGCTGAAGGTGAGTGG + Intergenic
947023525 2:225710968-225710990 ACAAAAATCTTGAAAGTGAGGGG - Intergenic
947090426 2:226504194-226504216 TGATAAATACTTAAAGTGATGGG + Intergenic
947129024 2:226902742-226902764 TGGAAAATGCTGAATGTTGGAGG + Intronic
947770105 2:232663728-232663750 TGATAAATGCTGGAGGTGATGGG - Intronic
948090782 2:235293034-235293056 AGAAAAATGCTGCAAGTCATAGG - Intergenic
948159355 2:235811641-235811663 TGAGAAATACAGAAAGTGTGCGG + Intronic
948565442 2:238883470-238883492 AGAAAAAAACAGAAAGTGAGGGG + Intronic
1169120296 20:3091893-3091915 AGAAAAATGCTGAGCCTGAGGGG + Intergenic
1169312025 20:4551071-4551093 TTAAAAATGCTGAGACAGAGAGG - Intergenic
1169527934 20:6450583-6450605 AGAAAATTGTTGAAAGTTAGTGG + Intergenic
1170610948 20:17912777-17912799 TGACAAATGATTAAAGTGAAGGG - Intergenic
1170731211 20:18976889-18976911 TAAAAAATGGTAAAAATGAGGGG - Intergenic
1171072577 20:22089157-22089179 GTAAAAATGCTGAAAGTCAAAGG - Intergenic
1174882007 20:54290156-54290178 TGAAAAACTCTGAAATTCAGTGG + Intergenic
1176997564 21:15574474-15574496 TGAAAAATGATGAAGGGGATGGG + Intergenic
1177512064 21:22100403-22100425 TGAAAAAGGCACAAATTGAGAGG + Intergenic
1178137488 21:29643668-29643690 TGTAAAATTGTGCAAGTGAGAGG - Intronic
1178636115 21:34305711-34305733 TGAATAATGCTTAAATTGATAGG + Intergenic
1178853873 21:36234948-36234970 TGATAAATGCTTAAGGTGATGGG - Intronic
1179403928 21:41110033-41110055 TTACAAATGAGGAAAGTGAGAGG + Intergenic
1181176977 22:21043473-21043495 TGAAAAATGTTGGAAGGGACAGG + Intergenic
1181565752 22:23736244-23736266 TGAAAAATGCGAAAATGGAGTGG + Intergenic
1181665326 22:24391583-24391605 TGAAAAATGCTCACAGTGAGGGG - Intronic
1185240849 22:49745157-49745179 ACAAAAATGCTGAAAGTAAAAGG - Intergenic
950817639 3:15723214-15723236 TAATAAATACTGAAAGTGTGAGG - Intronic
950955209 3:17045856-17045878 AGAAAAATTCTGAAAAAGAGAGG + Intronic
950975919 3:17244883-17244905 TTAAAAATTCTGTAAGTTAGAGG + Intronic
951046694 3:18047348-18047370 TGAAATGTGATGAAAGTGACAGG - Intronic
952196907 3:31085372-31085394 TGAGACACGCTGAAAGTGAAAGG + Intergenic
952271938 3:31841471-31841493 TGAAATCTGCAGAAAGTGTGTGG + Intronic
953258201 3:41310662-41310684 AGAGAAAGGCTGAAAGTAAGAGG + Intronic
954000364 3:47551936-47551958 TGAAAACTGATGAAAATGAAAGG - Intergenic
954958481 3:54543033-54543055 AGAAAAAGGCTGGAACTGAGAGG - Intronic
955081601 3:55662898-55662920 TGAGACATGCTGAATGAGAGAGG + Intronic
955263511 3:57418989-57419011 TGAAAAATGCTAAATGTAATAGG + Intronic
955476656 3:59343289-59343311 TAGAAAATGCTGAAAGAAAGGGG - Intergenic
955507911 3:59650421-59650443 TTCAAAATGCTGAAAGAGTGTGG + Intergenic
956134867 3:66088732-66088754 TGGAAAAGCCTGAAGGTGAGAGG + Intergenic
956871884 3:73426656-73426678 TCAAAAATGCTGGAAGAGGGAGG - Intronic
958147421 3:89644000-89644022 AGATAAATGCTTAAAGTGATGGG + Intergenic
959140004 3:102474199-102474221 TTCAAAATGCTGAAAGTGCTTGG + Intronic
959638464 3:108603174-108603196 TGATAAATTCTGGAAATGAGGGG + Intronic
959913043 3:111786596-111786618 TGAAAAAGGCTTAAAGTGGGAGG + Intronic
960348462 3:116564508-116564530 AGAAACATGCTGACACTGAGTGG - Intronic
960619860 3:119627340-119627362 TGAAAAATCTTTTAAGTGAGTGG - Intronic
960651133 3:119951273-119951295 CAAAAAATGCTGAAAGTGGCAGG + Intronic
961337556 3:126191215-126191237 TGAAAAATGCTGAATTTGACTGG + Intronic
962057208 3:131885131-131885153 ACAAAAATGCTGATAGTGATAGG + Intronic
962090072 3:132233953-132233975 GGAAAAATGCTGAGTGAGAGGGG + Intronic
962625201 3:137219240-137219262 GGGAAAATGTTGAAGGTGAGAGG + Intergenic
964129173 3:153268497-153268519 TAAAAAATGGTCAAAGTGAGAGG + Intergenic
964846778 3:161052857-161052879 AGAAGAAGGCTGAAAATGAGAGG - Intronic
965069747 3:163904551-163904573 TGAAAACTGTTTAAAGAGAGGGG - Intergenic
965684222 3:171284363-171284385 TTTAAAATGCTGCATGTGAGAGG - Intronic
965695053 3:171399826-171399848 TGGAAAATACTGAAAGAGAATGG - Intronic
965717372 3:171620084-171620106 TGATAAATGCTTGAAGTGATAGG + Intronic
965915515 3:173841780-173841802 TGAAATATGATGAAAAGGAGTGG + Intronic
966299331 3:178461318-178461340 ACAAAAATGCTGATAGTGATAGG + Intronic
967086541 3:186099744-186099766 TGAAGAATGCTGAAAGAGGAGGG + Intronic
967223540 3:187269718-187269740 TGAAAAATGGAAAAAATGAGAGG - Intronic
968874207 4:3256740-3256762 TGATAAGTGCTGGAAGGGAGGGG + Intronic
970112423 4:12653205-12653227 TGCACATTGTTGAAAGTGAGTGG + Intergenic
970812494 4:20111429-20111451 TTAAAAATGCTGTAAGAGTGAGG - Intergenic
970887631 4:21004857-21004879 TCAAAAATGCTAAAGGGGAGAGG + Intronic
971090165 4:23333888-23333910 TTAAAAATGATTAAGGTGAGTGG - Intergenic
971355569 4:25891868-25891890 AGAGAATTGCTGAAAGTCAGAGG - Intronic
971655520 4:29339734-29339756 TGATACATGCTTAAAGTGACAGG - Intergenic
972270523 4:37506856-37506878 TGTCCAATGCTGAAAGTGGGTGG + Intronic
973059325 4:45700808-45700830 TGGGAAAAGCTGAAAATGAGGGG - Intergenic
974337097 4:60563115-60563137 TGTAAAAGGCTGAGAGTGTGAGG + Intergenic
975110588 4:70618740-70618762 TGCAAAATGCTGACAGTGATAGG + Intergenic
975427102 4:74243036-74243058 TGAAAATTGATGAGAGAGAGAGG + Intronic
976176599 4:82360305-82360327 TTTAAAATGCAGAAAGTGATGGG + Intronic
976194714 4:82521624-82521646 TGTAAGATGCTGAAAGGGAATGG + Intronic
976418747 4:84812573-84812595 TGAAAATTGATGATAGTGATAGG - Intronic
977178395 4:93842337-93842359 TGAAAAATACTGCAAGAAAGTGG - Intergenic
978907551 4:114025679-114025701 AGAAATATGATGGAAGTGAGAGG - Intergenic
979126157 4:116974852-116974874 TCAAAAGTGCTGAAAGTAAAGGG - Intergenic
979309784 4:119189541-119189563 TGAGAAATGATGAAAGGAAGTGG - Intergenic
980375277 4:131938413-131938435 TGAAAAATGTGTAAAGGGAGAGG - Intergenic
981609406 4:146577484-146577506 TGAAAACTGTTGAAAATCAGAGG + Intergenic
981934439 4:150223883-150223905 TGAGAAATAATGAAAGTCAGGGG + Intronic
982206843 4:153003016-153003038 TGAACAATGCTGGACGTAAGTGG + Intergenic
982676496 4:158382000-158382022 TGAAAAAAGCTGAGAGTGACTGG + Intronic
983451438 4:167916560-167916582 TGAAAAAAGCGGGAAGAGAGAGG - Intergenic
983466484 4:168099333-168099355 TCAAAGATGCCGAAAGAGAGAGG + Intronic
983762978 4:171437230-171437252 TAAAATATGAAGAAAGTGAGAGG + Intergenic
984010309 4:174363125-174363147 TGAAAAATGCCGACATTGAGGGG + Intergenic
984568080 4:181355327-181355349 TGAGAAATGATGAAAATGGGTGG - Intergenic
986056005 5:4137290-4137312 TGGAAGATGCTGAAGGTGTGAGG + Intergenic
986434513 5:7715034-7715056 TGAGAGATGCTGGAAGTCAGAGG + Intronic
986447300 5:7832416-7832438 TGTAAGATGGGGAAAGTGAGAGG - Intronic
986662338 5:10070576-10070598 GGCAAAATGCTGAAAGTAAAAGG - Intergenic
986830948 5:11577593-11577615 TGACAAATACTGAATGTGTGTGG + Intronic
987741712 5:21917081-21917103 TGAAAAATGTTAAAGGTGAGAGG - Intronic
988374277 5:30414100-30414122 TGAAAAATCCTGAAAGGTACAGG + Intergenic
988607307 5:32689750-32689772 GGAAAAATGCTGGAAGGCAGGGG - Intronic
989661831 5:43808140-43808162 TGAAAAATAAGGAAACTGAGAGG + Intergenic
990074281 5:51823752-51823774 TGAAAAATGGTGATAATGAAGGG - Intergenic
990271175 5:54141354-54141376 TGAAAAAAGATGAAAGTGACTGG - Intronic
991458806 5:66834589-66834611 TGCAAAATGCTAAGAGTAAGGGG - Intronic
991471938 5:66978222-66978244 TGTAAAATTCAGAAAGTGAAGGG - Intronic
992195732 5:74337177-74337199 AGAAACATGCTGAAAGACAGAGG + Intergenic
993292656 5:86095328-86095350 TTAAGAATGGTGAAAGGGAGTGG - Intergenic
993336932 5:86671267-86671289 TGAGAAATGCTTTAAGTTAGGGG + Intergenic
994341482 5:98634203-98634225 TGAATAATACTAAAAGAGAGTGG - Intergenic
994519464 5:100812937-100812959 TGAAAACAGCTGAAAGAGTGTGG + Intronic
995160966 5:108981327-108981349 TCAAACAGGCTAAAAGTGAGGGG + Intronic
995313168 5:110736834-110736856 TGAGAAAGGGTGAAAGTGATAGG - Intronic
995490060 5:112681623-112681645 TGGAACATGCTGAAAGTGACTGG - Intergenic
995830372 5:116348423-116348445 TGAAAAATCCTGGGAGTGACAGG + Intronic
996009887 5:118470444-118470466 AGAAAAATGCTGAAAATAAAAGG - Intergenic
996248553 5:121297206-121297228 TGACAAATGTAGAAAGGGAGAGG - Intergenic
996458354 5:123711325-123711347 ACAAAAATGTTGAAAGTAAGAGG - Intergenic
996659380 5:125982509-125982531 TGAAAAATGCTTAAGGTGATGGG - Intergenic
996811751 5:127523474-127523496 AGAAAAATGATGGAAGAGAGTGG + Exonic
998737968 5:145164670-145164692 TGTCTAATGCTGAAAGTGGGAGG + Intergenic
999643312 5:153693698-153693720 TAAACAATTCTGACAGTGAGAGG - Intronic
999806802 5:155088961-155088983 TGATAAAAGCTGAAAGAGACTGG - Intergenic
1000007341 5:157199143-157199165 TGAAAAATGAGGCAACTGAGAGG + Intronic
1000519881 5:162282340-162282362 AGAGAAATGCAGCAAGTGAGAGG + Intergenic
1000689856 5:164303779-164303801 GTAAAAATGCTGAAACTGAACGG + Intergenic
1001551192 5:172603245-172603267 AGAAAAATGCTGAAAATCAGAGG + Intergenic
1001797239 5:174512959-174512981 TGAGAAATGCAGTAAGTGTGGGG + Intergenic
1002357070 5:178639254-178639276 TGAAAAAGGCTGAAGGTAAATGG - Intergenic
1003563236 6:7201437-7201459 AGAAAAAGGTTGACAGTGAGTGG - Intronic
1003804622 6:9713288-9713310 TGAAAAATTCTGTGGGTGAGTGG - Intronic
1004392897 6:15224125-15224147 AGAACAATGGAGAAAGTGAGAGG - Intergenic
1006090395 6:31625389-31625411 TGAACACAGCTGAAAGTGATGGG - Intronic
1007187018 6:39980545-39980567 TGACAACTGCTGATAGTGAGGGG + Intergenic
1010550614 6:77217971-77217993 AGAAATATGTAGAAAGTGAGGGG - Intergenic
1010768749 6:79804924-79804946 TGAAACTTTCTGAAAGTGTGTGG - Intergenic
1011117789 6:83913433-83913455 TAAAAAAGGCTGAAAATCAGAGG - Intronic
1013336507 6:109168474-109168496 TGAAGTATGCAGAAATTGAGTGG - Intergenic
1013690844 6:112640945-112640967 AGAGAAATTCTGAAAGTGAAAGG + Intergenic
1014566419 6:122954883-122954905 TCTAAAATGCTGGAAGAGAGTGG + Intergenic
1015291883 6:131546860-131546882 TGAGAAATGCTGACAGGTAGAGG - Intergenic
1015577636 6:134689967-134689989 TGAGAGATGCTGCAAGTGGGAGG + Intergenic
1016314057 6:142767188-142767210 TGAAGGCTGCTGAATGTGAGAGG + Intronic
1017043465 6:150325958-150325980 TTAAGAAAGCTGAAAGAGAGAGG + Intergenic
1017161848 6:151372729-151372751 GAATAAATGCTGAAAGTCAGGGG + Intronic
1017809533 6:157974875-157974897 TGAAAAATGAAACAAGTGAGGGG - Intergenic
1017939941 6:159043174-159043196 TGAAAAAAGTTGAGAGTGAATGG + Intronic
1018134961 6:160770310-160770332 GGATAAATGTTTAAAGTGAGGGG + Intergenic
1018264047 6:162001678-162001700 AGTAAAATGCTGAAAAGGAGTGG + Intronic
1018590477 6:165414915-165414937 TGAAAAATGCTCGAAGTGAGGGG - Intronic
1018602961 6:165565025-165565047 GGTAATAGGCTGAAAGTGAGAGG + Intronic
1020379897 7:7532161-7532183 TTAAACCTGCTGAAAGTGGGAGG + Intronic
1021236309 7:18146806-18146828 GGAAAAATGTTAAAAATGAGGGG - Intronic
1023079060 7:36510855-36510877 TGAAAAATGCTCATGGTGGGTGG + Intergenic
1023571130 7:41573073-41573095 TGAAAAATGCAGAGATTGAAAGG - Intergenic
1024280440 7:47714583-47714605 AGAAAAATACTGGAAGTGAGGGG - Intronic
1024670419 7:51589035-51589057 TGAAAAATGTTGGCAGTGAATGG + Intergenic
1024689356 7:51782387-51782409 TGATAAATGCTTGAAGTGATGGG + Intergenic
1025010064 7:55389434-55389456 AGAAAAAGGTTGAAAGTGAATGG + Intronic
1026206883 7:68265438-68265460 TAGAAACTGCTGACAGTGAGTGG - Intergenic
1028364896 7:90016423-90016445 TGAAAAAAGAAGAAAATGAGAGG + Intergenic
1029664291 7:101984696-101984718 TGAAAAATGCTGGAGGTGGCTGG + Intronic
1029853877 7:103493635-103493657 TGAGAAATGCTGACATTTAGAGG + Intronic
1029907924 7:104111031-104111053 TTTCAAATGCTGACAGTGAGAGG - Intergenic
1030686633 7:112493752-112493774 AAGAAAATGCTGAAAGTCAGGGG - Intergenic
1030841813 7:114362962-114362984 TGAGAAATGTTGAAAATGATAGG - Intronic
1031539763 7:122979238-122979260 TAATAAATTCTGAAAGTGGGGGG - Intergenic
1032013958 7:128364413-128364435 CTGAAAATGCTGAAAATGAGGGG + Intergenic
1032751598 7:134846926-134846948 TGAGAAATGTTGAAAGCAAGAGG + Intronic
1033022159 7:137736654-137736676 GGAAAAATACTGAAAGTAACGGG + Intronic
1033045360 7:137957313-137957335 AAAAAAATGCAGAAAGTAAGTGG - Intronic
1033441701 7:141386029-141386051 TGAGAAGTGCTGAAAGGTAGAGG - Intronic
1033535788 7:142310627-142310649 TGAATAATGGTGAAAGCGAAAGG - Intergenic
1033834932 7:145298883-145298905 TAAATAATGCTGTAATTGAGAGG - Intergenic
1036586044 8:10124496-10124518 TGGAAAATTCTAAAAGTGACTGG + Intronic
1037156836 8:15711142-15711164 AGGAAAATGCTGGTAGTGAGAGG - Intronic
1037541926 8:19880438-19880460 TGGAAAATACTGAAAGAGAGAGG - Intergenic
1037929601 8:22870645-22870667 TGGAGAATGTTGATAGTGAGTGG + Intronic
1038751809 8:30303186-30303208 TGACAAATGCTGTAAAGGAGAGG - Intergenic
1039110482 8:34036041-34036063 TGGAAACTGCTGAATGTAAGTGG - Intergenic
1039120701 8:34143037-34143059 TGAAAAATTCTGAGAGAGTGTGG + Intergenic
1040391307 8:46953093-46953115 TGAACTCTGCTGCAAGTGAGAGG - Intergenic
1041491973 8:58443148-58443170 AGAAATTTGCTGAGAGTGAGGGG - Intronic
1044438794 8:92198389-92198411 TGAAAAAATCTGCAAGTAAGAGG - Intergenic
1045207712 8:100059704-100059726 TGTCCAATGCTGAAAGTCAGAGG - Intronic
1045740294 8:105350529-105350551 TGAAAGATGAAGAAAATGAGAGG + Intronic
1046086269 8:109439510-109439532 TGAAAAATACTGTGAGTTAGAGG + Intronic
1046728017 8:117695328-117695350 TGAAAACAGCTGATTGTGAGAGG + Intergenic
1046867639 8:119168604-119168626 TGAAAGATGCCGAAAGTTAAGGG - Intronic
1048323369 8:133419256-133419278 TTAATAATGATGAAAATGAGTGG - Intergenic
1048541604 8:135347059-135347081 TGAAAAAGAATGAAAGTCAGGGG + Intergenic
1048782873 8:138021213-138021235 ACAAAAATGCTGATAGTGATAGG + Intergenic
1048915358 8:139177805-139177827 TGAGACATGGTGGAAGTGAGAGG - Intergenic
1049500229 8:142959282-142959304 TAAGAAATTCTAAAAGTGAGAGG + Intergenic
1049824886 8:144662123-144662145 TGGAAAATGGGGAAGGTGAGCGG - Intergenic
1050220224 9:3379553-3379575 TGAAACACACTGAAATTGAGTGG + Intronic
1051467183 9:17393001-17393023 TAGAAAATGCTAAAACTGAGAGG + Intronic
1051754132 9:20377074-20377096 AGAAAAATGTTACAAGTGAGAGG + Intronic
1051992322 9:23166410-23166432 TGTCTAATCCTGAAAGTGAGAGG - Intergenic
1052526780 9:29629021-29629043 TCCAAAATGCTGATAGTGACAGG + Intergenic
1053158463 9:35796627-35796649 TGAATAATGCCCACAGTGAGGGG - Intronic
1054784115 9:69194311-69194333 TGTAAATTGCTGAAAGTTATAGG + Intronic
1055695721 9:78882226-78882248 AGAAAAATGCTGAAATGGAGGGG - Intergenic
1055825968 9:80325145-80325167 TTAAAAATGCTGAGGGTGAATGG - Intergenic
1055993177 9:82129978-82130000 TGAAAAATGCTGGCTGTGAGTGG + Intergenic
1056513088 9:87324216-87324238 TGAATGATGGAGAAAGTGAGAGG - Intergenic
1059549473 9:115214523-115214545 ACAAAAGTCCTGAAAGTGAGGGG + Intronic
1060064366 9:120490270-120490292 TGAAAAATGCTGACAATTGGGGG - Intronic
1186131120 X:6466433-6466455 TGAACAATGCTAAAAGGGACAGG - Intergenic
1186166460 X:6831723-6831745 GGTAAAATGCTGAAAATGACTGG - Intergenic
1186305119 X:8248293-8248315 TGATAAACGCTGAAAGGGAGAGG + Intergenic
1186611475 X:11142112-11142134 TGGGAAATGCTGAAAATGGGAGG - Intronic
1186778211 X:12887037-12887059 AGAAAGATGCTGAAAATCAGAGG - Exonic
1189230701 X:39450528-39450550 TGAAAAATGAACAAAGAGAGGGG - Intergenic
1190415917 X:50180476-50180498 TCCAAAATGCTCAAAGAGAGTGG + Intergenic
1191733180 X:64359702-64359724 GGAAAAACTATGAAAGTGAGAGG + Intronic
1191874896 X:65786743-65786765 GGGAAAATGGGGAAAGTGAGGGG + Intergenic
1192015039 X:67320558-67320580 GGAAAAATGCAGAGAGAGAGGGG - Intergenic
1192940472 X:75906334-75906356 TGTTTAGTGCTGAAAGTGAGAGG + Intergenic
1193294936 X:79822817-79822839 TGGATAATGCTGAAATTGAATGG - Intergenic
1193550608 X:82888179-82888201 TGAATAATGCTGCAATTCAGTGG - Intergenic
1193796211 X:85877617-85877639 TGATAAATGCTTAAAGTGATGGG + Intronic
1194545045 X:95223783-95223805 GCAAAAATGTGGAAAGTGAGTGG - Intergenic
1194869637 X:99113249-99113271 TGGTAAGTGCTGAAAGTAAGAGG - Intergenic
1196625083 X:117869109-117869131 TCAAATATGCTAAAAGTTAGAGG - Intergenic
1196926947 X:120642802-120642824 TGGAAAATTCTGAATTTGAGAGG - Intergenic
1197008989 X:121537356-121537378 TAAAAAATGCAGAAATTGAGAGG - Intergenic
1197401629 X:125998976-125998998 TGAATAAGGCTGAGAGTGAGAGG + Intergenic
1197480577 X:126980181-126980203 TGGCAAAGGTTGAAAGTGAGAGG - Intergenic
1197506957 X:127317792-127317814 GGAAGAAGGATGAAAGTGAGAGG + Intergenic
1198558357 X:137820921-137820943 ATAAAAATGCTGAAAGTCAAAGG - Intergenic
1198785203 X:140280505-140280527 TGTCCAATGCTGAAAGTGAGGGG + Intergenic
1198860747 X:141066888-141066910 TGAGGAATGCTGAAAATGAAAGG - Intergenic
1198901945 X:141520498-141520520 TGAGGAATGCTGAAAATGAAAGG + Intergenic
1198977019 X:142347568-142347590 TGGCAAATGCTGAATGTGAAAGG - Intergenic
1199921571 X:152410394-152410416 TGAAAAATGCTTGAGGTGATGGG + Intronic
1201303408 Y:12530046-12530068 TGAAAAGAGGTGAAACTGAGTGG - Intergenic
1201482754 Y:14457749-14457771 GGAATAATGCTAAAAATGAGAGG + Intergenic