ID: 1118520573

View in Genome Browser
Species Human (GRCh38)
Location 14:66578926-66578948
Sequence TGCTGTATGTAAAGCTACAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 152}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118520573 Original CRISPR TGCTGTATGTAAAGCTACAA TGG Intronic
903645134 1:24890948-24890970 TGCTGTAATTAATGCTCCAAAGG + Intergenic
906118637 1:43372591-43372613 TGCTGTATGGAGAGTGACAATGG + Intergenic
908212481 1:61915292-61915314 TGCTGTATCTCAGGTTACAAGGG + Intronic
909490767 1:76224020-76224042 GGCTGCATGTAAAGCTAGACGGG - Intronic
911184851 1:94893252-94893274 TGCTCTGTTTAAAGCTAAAAGGG - Intronic
911248744 1:95550423-95550445 TGCTGTGTGTAAAGGTGCAGAGG - Intergenic
911394802 1:97292210-97292232 TGCTGTATTATAAGCTACATTGG + Intronic
911873481 1:103129217-103129239 TGTTCTATGTAAAGACACAAGGG - Intergenic
912434990 1:109655623-109655645 TGCTGTAGGCAAACCTACATGGG + Intergenic
912732189 1:112117359-112117381 AGCAGTATGTACAGCTACAAAGG + Intergenic
913062992 1:115225037-115225059 TGCTGTATGTAAAGACAGAAGGG + Intergenic
913427050 1:118744749-118744771 TGCTGTTTGTTAATGTACAATGG - Intergenic
914329771 1:146656097-146656119 TGCTCTATGTTATACTACAAAGG - Intergenic
916808077 1:168279728-168279750 TGCTGTATGTGATGCTTCATAGG + Intergenic
918271455 1:182905460-182905482 TGCTGTAAAAAAAACTACAAAGG + Intronic
918821286 1:189258279-189258301 TGCTGAATGTAAATCAACAAAGG + Intergenic
919106885 1:193164531-193164553 TTCTCTGTGTAAAGCTACATTGG + Intronic
919174772 1:194004980-194005002 TGCTGTTTGAAAATTTACAAGGG - Intergenic
920339567 1:205267490-205267512 TGCTGTGTGTAAAAATACATGGG + Intronic
921685029 1:218080318-218080340 TTCAGTATCTAAGGCTACAAAGG + Intergenic
921733985 1:218606064-218606086 TGCTGTATATATATATACAATGG + Intergenic
922768604 1:228169636-228169658 TACTGTATGTGATGCTACGATGG - Intronic
924584920 1:245353724-245353746 TGCTGTATTTAAAGCTGCTTTGG + Intronic
1062976245 10:1685644-1685666 TGCTGTATGCAAAGTGAGAAAGG - Intronic
1065355868 10:24841020-24841042 TTATGTATGTAAAGATAGAAAGG - Intergenic
1066645005 10:37597537-37597559 TGCTTTAGGTGAAGGTACAAGGG + Intergenic
1070069088 10:73068504-73068526 CTTTGTATGTAAAGCTATAAGGG - Intronic
1070656122 10:78272687-78272709 TGGTCTTTGTCAAGCTACAAGGG - Intergenic
1075869890 10:125763771-125763793 TGAAGTATGTCAAGCTACACGGG + Intronic
1077707672 11:4503607-4503629 AGTTGTACGTAAAGCTACAATGG + Intergenic
1078886484 11:15505417-15505439 TGCTGTTGGTTAAGCAACAAAGG + Intergenic
1079607948 11:22393214-22393236 TCCAGTATGTACAGCTTCAACGG + Intergenic
1081223970 11:40498259-40498281 TCCTGGAAGTAACGCTACAACGG + Intronic
1081792102 11:45795461-45795483 TGCTGGATGGCAAGCTACCAGGG - Intergenic
1092131260 12:6114792-6114814 TGCGGTAGGTGAAGCTCCAAGGG - Intronic
1092971012 12:13695051-13695073 TGTTCTATGGAAAGCTGCAAAGG + Intronic
1094544434 12:31391331-31391353 TGCTGAATGTCAAGGTACATTGG - Intronic
1095829792 12:46572227-46572249 TGCTGTTTGGAAAGCCTCAAAGG - Intergenic
1098172908 12:67764781-67764803 TGCTGTATCTAAAACTATAAGGG + Intergenic
1102072865 12:110036119-110036141 TGCTGTGTGAAAAGCTAACAGGG - Intronic
1102724428 12:115047451-115047473 TGCTGGATATAAAACTGCAAAGG + Intergenic
1110087885 13:71405174-71405196 TGCTTTATGGATAGCAACAAAGG - Intergenic
1110274215 13:73625445-73625467 TGCTGTCTTTAAAGATACATAGG + Intergenic
1110987595 13:81990816-81990838 TGGGGTATGAAAAGCCACAATGG + Intergenic
1111036564 13:82682034-82682056 TGTTTTGTGTACAGCTACAAAGG - Intergenic
1113396293 13:109950694-109950716 TGCTGTATGTAATACTATGATGG - Intergenic
1118520573 14:66578926-66578948 TGCTGTATGTAAAGCTACAATGG + Intronic
1118864942 14:69695376-69695398 TGCTGTATCCAAAACCACAATGG + Intronic
1119394623 14:74317163-74317185 TGCTGTATGGAGAGCTAGAATGG + Intronic
1120176252 14:81296533-81296555 TGCTGTGTGTCTAGCTGCAAAGG - Intronic
1125088668 15:35764135-35764157 TGCTGTATATCAAAGTACAATGG + Intergenic
1125341488 15:38679869-38679891 TTCTTTCTGTAAAGCTTCAATGG + Intergenic
1127700453 15:61494893-61494915 TGTTATATGTAATCCTACAATGG + Intergenic
1129622226 15:77158509-77158531 TGCTGTATGTTGCACTACAAGGG + Exonic
1134253271 16:12589987-12590009 TGCTGTATGTAAAGGAACATGGG + Intergenic
1134267858 16:12707133-12707155 TGTTGTGTTCAAAGCTACAAAGG - Intronic
1137021004 16:35427591-35427613 TGCTGTAAGAAAAGTTACAAGGG + Intergenic
1137034218 16:35555493-35555515 TGCTGTAAGAAAAATTACAAGGG + Intergenic
1137446128 16:48533604-48533626 TGCTGGATGTAAATGGACAATGG + Intergenic
1139254227 16:65525723-65525745 TGCTGTATGAATAACTACAGTGG + Intergenic
1140003789 16:71054836-71054858 TGCTCTATGTTATACTACAAAGG + Intronic
1140163282 16:72522275-72522297 TGCTGTAGGTAAACCTGCACTGG - Intergenic
1145216369 17:21055627-21055649 TTATGTGTGTAAAGCTATAAAGG - Intergenic
1147897418 17:43759748-43759770 TCCTGTATGGAAAGCTTCATTGG + Intergenic
1150985069 17:70186605-70186627 TGCTGTTTGTAAAACTAGACTGG + Intergenic
1158948493 18:62468906-62468928 TGATGTATGTAAAGCAACTTAGG + Intergenic
928208701 2:29307016-29307038 TCCTGTATGTAAAGCCGGAACGG + Intronic
928359878 2:30654582-30654604 TGCTCTCTGCAAAGCTCCAAAGG + Intergenic
928865314 2:35910728-35910750 AACTGTATGAAAAACTACAAGGG + Intergenic
938941063 2:136170069-136170091 TTCTGTAGGTAAAGTTCCAAAGG + Intergenic
939485338 2:142805093-142805115 TGCTATATTTAAAACTACATTGG + Intergenic
940891046 2:159035793-159035815 TTCTGAGTTTAAAGCTACAAAGG - Intronic
943945836 2:194062589-194062611 TGCTGCATCTACAGTTACAAGGG - Intergenic
944459155 2:199927022-199927044 TGCTATAAGAAAAGTTACAAGGG + Exonic
945375253 2:209072293-209072315 TCTTTTATGTACAGCTACAAAGG + Intergenic
945857463 2:215085637-215085659 TTGTGTACGTAAAGCTAAAATGG - Intronic
946755526 2:222942066-222942088 TACTGTATTTAAAAATACAAGGG + Exonic
946780069 2:223185598-223185620 TGCTATATATAAACCAACAATGG + Intronic
947075142 2:226334719-226334741 TGCTGTATGGTAAGCTCCAAAGG - Intergenic
948160928 2:235823492-235823514 TGCTGTTTTTAAAGCTAGAAGGG + Intronic
948556794 2:238817473-238817495 TGCTACCTGTAAAGCTGCAAAGG - Intergenic
1168868561 20:1109482-1109504 TGCTGGATGTCAAGCAACCAGGG + Intergenic
1168941144 20:1712252-1712274 TCCTTTATGTGAAGCTACCAGGG - Intergenic
1169557407 20:6766266-6766288 TGCTGTTTCTAAAGGTATAAAGG - Intergenic
1171542361 20:25972717-25972739 TGCTGAATTTAAACCTGCAAAGG + Intergenic
1174458694 20:50667714-50667736 TGCTCTAGGAAAAGCTTCAAGGG - Intronic
1175619809 20:60433971-60433993 TTTTGTGTGTAAAGTTACAAGGG + Intergenic
1177341199 21:19802527-19802549 TGCTGTTTGTTAAGCTTCACAGG - Intergenic
1177428113 21:20952599-20952621 TGCTTTAGGTAAAGCTACAAAGG + Intergenic
1180849544 22:19008150-19008172 TGTTGTATGTAAAGCTCTACTGG + Intergenic
1182892511 22:33830814-33830836 TGCTGTCTGTGAAGCAGCAAGGG - Intronic
1183110512 22:35645395-35645417 TGCTGTACGCCAAGCAACAAGGG + Intergenic
950328149 3:12132559-12132581 TTCAGTCTGTAAAGATACAAAGG - Intronic
950878438 3:16300696-16300718 TGCTGTAAGTACTCCTACAATGG + Intronic
952781813 3:37107723-37107745 TGCAGAATGTAAAGATAGAAAGG + Intronic
955574223 3:60341800-60341822 GGCTGTGTGTAAGGCTACCAGGG + Intronic
957240095 3:77648635-77648657 TGCTGTATGTAGCTATACAAAGG + Intronic
957400349 3:79704283-79704305 TTCTGTATGTGATACTACAAGGG - Intronic
962849293 3:139295859-139295881 TGCTGTATGGAAAGGTGGAAGGG - Intronic
963658884 3:148098285-148098307 TACCGGATGTAGAGCTACAAAGG + Intergenic
963932862 3:151022249-151022271 TGCTTTATGCAAAGCTCCCAGGG + Intergenic
965426379 3:168529074-168529096 TACTCTATGTAATACTACAATGG - Intergenic
966513434 3:180790145-180790167 TGCTGTATCTAAAGCATCTATGG - Intronic
968171692 3:196515469-196515491 TGCTGTATGTTAATGTACTATGG - Intergenic
970675589 4:18445990-18446012 TGTTGTATTTAAATATACAATGG - Intergenic
974300368 4:60058402-60058424 TGTTTTATGTAAAGTTAAAAGGG - Intergenic
974927725 4:68321835-68321857 AGCTGTATGCAAATCTACACAGG + Intronic
975447876 4:74487965-74487987 TACTGTATCTAAACCAACAAAGG + Intergenic
975588536 4:75976957-75976979 TGCTGTATTTAAAGAAAAAAAGG - Intronic
977085584 4:92593480-92593502 TACTGTAGCCAAAGCTACAAAGG - Intronic
979457242 4:120940854-120940876 TGCAGTATGTATTGCTCCAAAGG - Intergenic
980853658 4:138413204-138413226 TACTGTTTGAAAATCTACAAAGG + Intergenic
983993181 4:174147599-174147621 TGCTGTATATGAAGCAAAAAGGG - Intergenic
984960950 4:185098068-185098090 AGCTGTATGTAAAGTTACGTTGG - Intergenic
988121621 5:26971108-26971130 AGCTTTATGCAAAGCTAAAATGG + Intronic
988228912 5:28449284-28449306 TGCTGTGTGGAATGCTATAATGG - Intergenic
990990778 5:61681640-61681662 TGCTTTATTTAAATCTAAAATGG - Intronic
992113506 5:73517767-73517789 TGCTATATATATAGATACAAAGG + Intergenic
994075448 5:95644818-95644840 TGATGTTTGGAAAGCTATAATGG - Intergenic
997164642 5:131646878-131646900 TACTGTATGTAATGGCACAAGGG + Intronic
999249581 5:150174349-150174371 TGCTGTTTGTAAATCTTAAATGG + Intronic
1000840447 5:166211428-166211450 GGCTCTGTGTAAAGCTATAAAGG - Intergenic
1001510986 5:172321620-172321642 TGCTGTAAGTAAAGGAAGAAAGG - Intergenic
1002787319 6:412469-412491 TTCTGAAAGTAAAGCTTCAAGGG - Intergenic
1003762521 6:9196353-9196375 TGCTGTATCAAAATCTAAAAGGG + Intergenic
1011394512 6:86891928-86891950 TCCTTTGTGTTAAGCTACAAGGG - Intergenic
1011897172 6:92242970-92242992 TGAAATATGTAAAGCTTCAAAGG - Intergenic
1012346469 6:98193536-98193558 TGATGTAAGTGTAGCTACAAAGG + Intergenic
1014815838 6:125934545-125934567 TGCTGTCTTTAAACCTAGAAGGG - Intergenic
1014823046 6:126014663-126014685 TGCTGTATTTAAAATTACCATGG + Intronic
1017114142 6:150960972-150960994 TGCTTTCTGTAAAGCTTCCATGG + Intronic
1017515385 6:155151723-155151745 TGCTGGGTGTATAGATACAAGGG + Intronic
1017702327 6:157087206-157087228 TGCTAAATGCAAAGCTACATGGG + Intronic
1019845783 7:3499588-3499610 TGCTTTATGCAAAACAACAATGG - Intronic
1020489709 7:8765907-8765929 TGATGTATGTTAATCTAGAAAGG + Intergenic
1021849403 7:24792727-24792749 TGCTGTTTGTACAGCAAAAAAGG - Intergenic
1023799455 7:43821322-43821344 TGCTGTTTGTACAGCAAAAAGGG + Intergenic
1024496447 7:50052655-50052677 TGTTGCATGTAAAGCTTCTATGG - Intronic
1025771106 7:64508338-64508360 TGCTGTATGTGAATCTGCCAAGG + Intergenic
1027583687 7:80030053-80030075 TACTTTATATACAGCTACAAAGG + Intergenic
1030317238 7:108128196-108128218 GGCTGTATGTAAGGCTGCACTGG - Intronic
1033535825 7:142311136-142311158 TGTTATATGTAAATCTACATGGG - Intergenic
1036177488 8:6553006-6553028 TGCTCTGTGTGATGCTACAATGG + Intronic
1036468240 8:9023722-9023744 TGCTGTATATAATGCTAATAAGG + Intronic
1038270048 8:26067701-26067723 TGGTTTATGTGAAACTACAAAGG - Intergenic
1042941567 8:74113882-74113904 AGCTTGATGTAAAGCTAGAATGG - Intergenic
1044519521 8:93182284-93182306 TCCTTTATGTAAAGGTAGAAAGG + Intergenic
1046946850 8:119982063-119982085 TGCTGTCAGTAAAACTCCAAAGG - Intronic
1047384340 8:124395553-124395575 TCCTTTGTGTAAAGCTACCAGGG + Intergenic
1048050354 8:130810477-130810499 TTCTTTATGCAAAGCCACAAGGG - Intronic
1049911608 9:274056-274078 TATTTTATGTAAAGTTACAAAGG + Intronic
1050439451 9:5645756-5645778 TGCAGTATGTACATATACAATGG - Intronic
1050658642 9:7858184-7858206 TGCAGTAAGGAAAGCTAAAATGG + Intronic
1050963969 9:11772727-11772749 TATTGGATGTAAAGCTACTATGG + Intergenic
1051006633 9:12353094-12353116 TACTATATGTAAAGGTGCAAAGG - Intergenic
1051744927 9:20286560-20286582 TGCTCTATGTTATGCTGCAAGGG + Intergenic
1056543490 9:87594260-87594282 TTGTGTCTGTAAAGCCACAAGGG - Intronic
1057457375 9:95226888-95226910 TGATGGATGTAGAGCTACAAAGG + Intronic
1060393125 9:123295603-123295625 AGCAGTCTATAAAGCTACAAAGG - Intergenic
1060948819 9:127587591-127587613 TGCACTATGGAATGCTACAAAGG - Intergenic
1190444311 X:50507995-50508017 TGTTGTATGTATAACTACCAGGG - Intergenic
1195512956 X:105738826-105738848 TGCTTTTTTTAAAGCTGCAAAGG - Intronic
1197321283 X:125034171-125034193 TCCTGTCTGTGAAGCAACAATGG - Intergenic
1198734913 X:139774908-139774930 TGCTGCATGCAGAGCTTCAATGG + Exonic
1201273894 Y:12281408-12281430 TGCTCTGTGTAATACTACAATGG + Intergenic
1201385780 Y:13438145-13438167 GGCTCTATATAAAGCTACAAAGG + Intronic