ID: 1118522061

View in Genome Browser
Species Human (GRCh38)
Location 14:66596507-66596529
Sequence CCTCTTTGGTACCCAAAGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 246
Summary {0: 1, 1: 0, 2: 2, 3: 58, 4: 185}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118522053_1118522061 -1 Left 1118522053 14:66596485-66596507 CCCCTGTCAGCCTTTCTCCCATC 0: 1
1: 0
2: 1
3: 41
4: 418
Right 1118522061 14:66596507-66596529 CCTCTTTGGTACCCAAAGTCTGG 0: 1
1: 0
2: 2
3: 58
4: 185
1118522055_1118522061 -3 Left 1118522055 14:66596487-66596509 CCTGTCAGCCTTTCTCCCATCCT 0: 1
1: 2
2: 2
3: 49
4: 556
Right 1118522061 14:66596507-66596529 CCTCTTTGGTACCCAAAGTCTGG 0: 1
1: 0
2: 2
3: 58
4: 185
1118522051_1118522061 10 Left 1118522051 14:66596474-66596496 CCACTCTTAGCCCCCTGTCAGCC 0: 1
1: 0
2: 2
3: 26
4: 238
Right 1118522061 14:66596507-66596529 CCTCTTTGGTACCCAAAGTCTGG 0: 1
1: 0
2: 2
3: 58
4: 185
1118522050_1118522061 21 Left 1118522050 14:66596463-66596485 CCTGCATCAAGCCACTCTTAGCC 0: 1
1: 0
2: 0
3: 15
4: 124
Right 1118522061 14:66596507-66596529 CCTCTTTGGTACCCAAAGTCTGG 0: 1
1: 0
2: 2
3: 58
4: 185
1118522054_1118522061 -2 Left 1118522054 14:66596486-66596508 CCCTGTCAGCCTTTCTCCCATCC 0: 1
1: 0
2: 1
3: 50
4: 501
Right 1118522061 14:66596507-66596529 CCTCTTTGGTACCCAAAGTCTGG 0: 1
1: 0
2: 2
3: 58
4: 185
1118522049_1118522061 29 Left 1118522049 14:66596455-66596477 CCTGCAGGCCTGCATCAAGCCAC 0: 1
1: 4
2: 12
3: 37
4: 211
Right 1118522061 14:66596507-66596529 CCTCTTTGGTACCCAAAGTCTGG 0: 1
1: 0
2: 2
3: 58
4: 185
1118522052_1118522061 0 Left 1118522052 14:66596484-66596506 CCCCCTGTCAGCCTTTCTCCCAT 0: 1
1: 0
2: 1
3: 33
4: 433
Right 1118522061 14:66596507-66596529 CCTCTTTGGTACCCAAAGTCTGG 0: 1
1: 0
2: 2
3: 58
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118522061 Original CRISPR CCTCTTTGGTACCCAAAGTC TGG Intronic
902956991 1:19932184-19932206 CCCGTAGGGTACCCAAAGTCCGG + Intergenic
903101687 1:21035623-21035645 GGTCTTTGGCACCCAAAGTTTGG - Intronic
904242421 1:29156755-29156777 CCCGTAGGGTACCCAAAGTCTGG + Intronic
905215234 1:36401873-36401895 GCTTATTGGCACCCAAAGTCTGG + Intergenic
907020151 1:51059379-51059401 GCTCTTCAGTTCCCAAAGTCTGG - Intergenic
907040436 1:51254096-51254118 CCTCTTTGGTGACCAAAATGTGG + Intronic
907614748 1:55912749-55912771 GCTCATTGGCACCCAAAGTCTGG - Intergenic
912093714 1:106114007-106114029 GCTCATTGGTGCCCAAAGTCTGG - Intergenic
912132479 1:106619728-106619750 GCTCCTTGGTGCCCAAAGTCGGG - Intergenic
912864174 1:113242429-113242451 TCTCTTTGCTCCACAAAGTCTGG + Intergenic
915185153 1:154098946-154098968 GCTTGTTGGTGCCCAAAGTCTGG + Intronic
915254300 1:154614312-154614334 CCTCTGTGCTAGCCAGAGTCAGG - Intronic
915637374 1:157196014-157196036 GCTCCTTGGCACCCAAAGTCTGG - Intergenic
915797444 1:158752017-158752039 GCTTCTTGGTGCCCAAAGTCTGG + Intergenic
916897728 1:169182853-169182875 CCTCTTGGTTACCAATAGTCTGG + Intronic
917848869 1:179043172-179043194 GCTCATTGGTGCCCAAAGTCCGG + Intronic
919453938 1:197801268-197801290 GTTCATTGGTGCCCAAAGTCTGG - Intergenic
921406779 1:214788969-214788991 CCATTCTGGAACCCAAAGTCAGG - Intergenic
921706030 1:218323732-218323754 GCTTGTTGGCACCCAAAGTCCGG + Intronic
922337147 1:224627174-224627196 CCTCTTTGGTAGCCTCATTCTGG + Intronic
923549054 1:234947032-234947054 CCTCATTGTTAGCCAAGGTCAGG + Intergenic
923755222 1:236785679-236785701 GCTTGTTGGTGCCCAAAGTCTGG - Intergenic
924179403 1:241424961-241424983 GCTTTTTGGTGCCCAAGGTCCGG - Intergenic
1065854648 10:29820514-29820536 CCTCTTTGGTACCTAATTACAGG + Intergenic
1065976508 10:30846983-30847005 GCTTATTGGCACCCAAAGTCTGG - Intronic
1066654472 10:37685671-37685693 CCTGTAGGGTACCCAAAGTCCGG - Intergenic
1068157758 10:53223106-53223128 GCTCGTTGGTGCCCAAAGTCTGG + Intergenic
1070096270 10:73340659-73340681 GCTCGTGGGTGCCCAAAGTCTGG + Intronic
1071301162 10:84257095-84257117 CCTCTTTGTTAAAGAAAGTCAGG + Intronic
1071819457 10:89264997-89265019 GCTCATTGGCCCCCAAAGTCTGG + Intronic
1071933110 10:90496251-90496273 TCCCTTTGGTACCCAAAGCTAGG + Intergenic
1074248001 10:111713961-111713983 GCTCCTTGGTGCCCAAAGTCTGG + Intergenic
1076244800 10:128938479-128938501 CCTCTTCTCTAGCCAAAGTCAGG - Intergenic
1077012739 11:386068-386090 ACTCATTGGTGCCCAAAGTCTGG - Intergenic
1078874248 11:15378012-15378034 GCTCTTCGGTGTCCAAAGTCTGG - Intergenic
1081011040 11:37812530-37812552 GCTCATAGGTGCCCAAAGTCCGG + Intergenic
1081406750 11:42707318-42707340 CCTCTTTGGAAGCCAGAGGCTGG + Intergenic
1085212231 11:74791525-74791547 CCTCTGGGGTGCCCAAAGTCTGG + Intronic
1085435128 11:76493251-76493273 GCTCATTGGCACCCAAAGTCTGG - Intronic
1085456414 11:76667941-76667963 CTTCTTTGGTTCCCCAAGTCTGG + Intronic
1087037959 11:93773338-93773360 GCTTGTTGGTACCCAAAGTCTGG + Intronic
1088855749 11:113751625-113751647 CCTCCTTGGCTCCCAAAGTGCGG - Intronic
1090945152 11:131423016-131423038 CATCTTTGCTACACAAAGTGTGG + Intronic
1092121154 12:6044789-6044811 CCTTTTTAGCACCCAAACTCAGG - Intronic
1092871560 12:12810313-12810335 CCCGTAGGGTACCCAAAGTCCGG + Intronic
1094018033 12:25884808-25884830 GCTCGTCGGCACCCAAAGTCCGG - Intergenic
1095444143 12:42267823-42267845 GCTTGTTGGCACCCAAAGTCTGG + Intronic
1095616891 12:44200880-44200902 CCTCTTGGATACAGAAAGTCTGG + Intronic
1098465683 12:70783815-70783837 TCTTTTTGGCACCCAAAGTCTGG + Intronic
1103173620 12:118843528-118843550 ACTCCTCGGCACCCAAAGTCTGG - Intergenic
1104388062 12:128367975-128367997 CCTCTTTCATCTCCAAAGTCCGG - Intronic
1104483768 12:129131258-129131280 CATCTTTGGACCCCAAAATCAGG - Intronic
1104742470 12:131188608-131188630 GCTCTTCAGCACCCAAAGTCTGG - Intergenic
1105039341 12:132949524-132949546 CCCGTAGGGTACCCAAAGTCCGG - Intronic
1106816245 13:33410499-33410521 CTTCTTTGTTACCCAAAATGAGG - Intergenic
1106979170 13:35256662-35256684 GCTCTTTGGCACCCAATGTCTGG + Intronic
1109426178 13:62168246-62168268 GCTCAGTGGCACCCAAAGTCTGG - Intergenic
1109470594 13:62799310-62799332 GCTCATTGGCACCCAAAGTCCGG - Intergenic
1109478730 13:62919607-62919629 GCTCGTTGGCACCCAAATTCCGG + Intergenic
1110439171 13:75508139-75508161 ACTCATTGGCATCCAAAGTCTGG + Intergenic
1111202889 13:84962272-84962294 GCTCATTGGTGCCCAAAGTCCGG + Intergenic
1111487829 13:88927020-88927042 GCACATTGGTGCCCAAAGTCTGG + Intergenic
1111505676 13:89185577-89185599 ACTTATTGGCACCCAAAGTCTGG - Intergenic
1111744076 13:92243868-92243890 CCTTTTTGGTACCTAAAATTTGG + Intronic
1111842992 13:93473301-93473323 ACTCTTTGGTGCCCAAAGTATGG + Intronic
1112086059 13:96033772-96033794 GCCCATTGGTGCCCAAAGTCTGG - Intronic
1113617701 13:111692838-111692860 CCTCTTTGGTCCCCACACCCTGG - Intergenic
1113623232 13:111778099-111778121 CCTCTTTGGTCCCCACACCCTGG - Intergenic
1114672744 14:24420531-24420553 CCTCTTTGCAGCCCACAGTCAGG + Intergenic
1116083434 14:40204712-40204734 TCTTCTTGATACCCAAAGTCTGG + Intergenic
1117199062 14:53370216-53370238 AATCTTTGGTACCCAAAGAGTGG + Intergenic
1118522061 14:66596507-66596529 CCTCTTTGGTACCCAAAGTCTGG + Intronic
1120405678 14:84091141-84091163 GCTTGTTGGGACCCAAAGTCAGG - Intergenic
1120496402 14:85242497-85242519 GCTCTTTGGTCCCCACAATCTGG + Intergenic
1122038664 14:98966307-98966329 CCTCTTTGGAAGCCAAATACAGG - Intergenic
1123888307 15:24749176-24749198 GCTCTTTGGTGACCAAAGTCTGG - Intergenic
1125752317 15:42037050-42037072 GCTCGTTGGCACCCAAAGTCTGG - Intronic
1134001409 16:10785897-10785919 CCTGTAGGGTACCCAAAGTCCGG - Intronic
1134206743 16:12244247-12244269 CCACTTTGGCACCCTAAGGCAGG - Intronic
1134241401 16:12509525-12509547 CCTCCATGGGACCCAAAGACAGG - Intronic
1134337655 16:13316147-13316169 CCTGGTTGCTACCCACAGTCTGG + Intergenic
1135814518 16:25619926-25619948 ACTCTTTGGGAACCCAAGTCAGG + Intergenic
1142940728 17:3378269-3378291 ACTCTTTGGTGTCCAAAGTCTGG + Intergenic
1143621440 17:8082802-8082824 CCTGTAGGGTACCCAAAGTCCGG - Intronic
1148874582 17:50679394-50679416 ACTCCTTGGTACGCAAAGTGTGG + Intronic
1150520991 17:65866324-65866346 GCCCGTTGGTGCCCAAAGTCTGG - Intronic
1150619161 17:66796444-66796466 GCATTTTGGTACACAAAGTCTGG - Intronic
1151395362 17:73819553-73819575 GCTCCTTGGTGCCCAAAGTTTGG + Intergenic
1153796138 18:8623980-8624002 CCTCATTGGTGCCCAGAGACGGG + Intronic
1155431784 18:25767138-25767160 ACACTTTGGTACCAAGAGTCAGG + Intergenic
1155683592 18:28520120-28520142 CCACTTTGGTCCCGACAGTCTGG + Intergenic
1155819136 18:30352760-30352782 GCTCGTCAGTACCCAAAGTCTGG - Intergenic
1156508204 18:37612553-37612575 CCTTTTAGTTACCCAAAGTCAGG - Intergenic
1157042948 18:44061350-44061372 GCTCGTTGGTGCCCAAAGTGTGG + Intergenic
1159623813 18:70669396-70669418 GCTCCTTGGTGCCCAAAGTCTGG - Intergenic
1161124401 19:2547677-2547699 CATCTTTGGTACCCAGTGTCTGG - Intronic
1163669556 19:18619448-18619470 CCTCTGTGGTGCCCAGAGCCTGG + Intronic
1165022569 19:32936294-32936316 GCTCATGGGTGCCCAAAGTCTGG - Intronic
1165079044 19:33297427-33297449 CCTCTTGGCTAAACAAAGTCAGG + Intergenic
1165912628 19:39238331-39238353 CCACTTTGGTACGCCAAGGCAGG + Intergenic
1166672465 19:44719094-44719116 ATTCCTTGGTTCCCAAAGTCTGG - Intergenic
1166897208 19:46031421-46031443 CCCGTAGGGTACCCAAAGTCCGG - Intergenic
1166897425 19:46032711-46032733 GCTCATCGGTGCCCAAAGTCTGG - Intergenic
1168439524 19:56351964-56351986 ACACTTTCTTACCCAAAGTCAGG + Intronic
1168466900 19:56609887-56609909 CCTCATTTGTACACAATGTCCGG - Intronic
925048140 2:789986-790008 GCTCCTTGGTGCCCAAAGTCTGG - Intergenic
925515252 2:4674538-4674560 GCTCCTTGGCACCCAAAGTCTGG - Intergenic
926145778 2:10396497-10396519 CCTCTGTGGTCCACAAACTCAGG - Intronic
926155239 2:10449722-10449744 CTTCCTTGGTACCCAAAACCAGG + Intergenic
926953720 2:18271720-18271742 GCTCGTTGGTGCCCAAAGTTTGG + Intronic
927533911 2:23837130-23837152 GCTCATCGGCACCCAAAGTCTGG + Intronic
930800512 2:55438308-55438330 ACTCGTGGGTGCCCAAAGTCCGG - Intergenic
931282216 2:60804501-60804523 GCTCCTCGGTGCCCAAAGTCCGG + Intergenic
931552779 2:63465433-63465455 CCACTTTGGGATCCAAAGTGAGG + Intronic
933801208 2:85961581-85961603 GCTCGTTGGTGACCAAAGTCTGG + Intergenic
936040621 2:109146657-109146679 CTGCTTTGGTCCCCAAAGTCAGG + Intronic
936290143 2:111216910-111216932 TCTCATTGGTACCCAAATTCTGG + Intergenic
938282394 2:130073754-130073776 CCTCTTTTGTACCCCAACTTGGG - Exonic
938333024 2:130462326-130462348 CCTCTTTTGTACCCCAACTTGGG - Exonic
938356785 2:130658345-130658367 CCTCTTTTGTACCCCAACTTGGG + Intergenic
938433221 2:131265151-131265173 CCTCTTTTGTACCCCAACTTGGG + Exonic
938732619 2:134158359-134158381 GTTCATTGGTGCCCAAAGTCTGG + Intronic
939466353 2:142561979-142562001 GCTCGTTGGCACCCAAAGTCTGG - Intergenic
940868291 2:158838342-158838364 CCTCGTTGGTACCCCAAGTGTGG - Intronic
941658537 2:168170620-168170642 CCACTTTGCCACTCAAAGTCTGG - Intronic
942114404 2:172713499-172713521 GCTTGTTGGTGCCCAAAGTCTGG + Intergenic
942585117 2:177466612-177466634 GCTCATTGGTGCCCAAAGTCTGG + Intronic
942616383 2:177795586-177795608 CTTCTTGGGTACCTAAAGTCAGG + Intronic
942868114 2:180699881-180699903 GCTCACTGGTGCCCAAAGTCTGG + Intergenic
942934183 2:181534110-181534132 CTCCTTTGGTTCCCAAAGTGTGG - Intronic
948334974 2:237200678-237200700 GCTCATTGGTGCCCAAAGTCCGG + Intergenic
1170314993 20:15031991-15032013 ACTCGTGAGTACCCAAAGTCCGG + Intronic
1170873423 20:20229370-20229392 GTTCTGTGGTTCCCAAAGTCAGG - Intronic
1171155185 20:22865491-22865513 CCTCTTGGGTCACCAGAGTCGGG - Intergenic
1176890597 21:14313460-14313482 TATCTCTGGTACGCAAAGTCAGG + Intergenic
1177344948 21:19855717-19855739 GCTCATTGGTGCCCAAAGTCTGG + Intergenic
1183250953 22:36730066-36730088 CCTCTCTGGTACCCTAAGCATGG + Intergenic
1183393013 22:37556579-37556601 CCCCTTTGTACCCCAAAGTCTGG - Intergenic
949756381 3:7415808-7415830 CCTCTATGTTGCCCAGAGTCTGG + Intronic
953204815 3:40816142-40816164 CCTCATTGGCACCCATAGGCAGG + Intergenic
953748240 3:45591362-45591384 GCTCATCGGCACCCAAAGTCTGG + Intronic
957775933 3:84757177-84757199 GCTCATTGGTGCCCAAAGTTTGG + Intergenic
958584522 3:96069261-96069283 GCTCCTTGGTGCCCAAAGTCTGG + Intergenic
959252487 3:103965997-103966019 GCTCATTGGTGCCCAAAATCTGG - Intergenic
959580909 3:107981643-107981665 CCTCTGTTGTACACAAAGCCAGG + Intergenic
959897038 3:111617091-111617113 GCTCCTTGGCGCCCAAAGTCTGG - Intronic
960011191 3:112835754-112835776 GCTTATTGGTGCCCAAAGTCTGG + Intronic
960403760 3:117235140-117235162 CTTCTTTGATACCCATAGTCAGG + Intergenic
963139232 3:141933907-141933929 CCTCTTTGGTCCCAGAAATCTGG - Intergenic
963483310 3:145904118-145904140 GCTCATTGGTGCCCAAAGTCTGG - Intergenic
964975522 3:162614871-162614893 GCTCGTTGGTGCCCAAAGTCTGG + Intergenic
965261305 3:166489487-166489509 GCTCTTTGGTATCCAAAGCCTGG - Intergenic
965774051 3:172209869-172209891 GCTCGTTGGTGCCCAACGTCTGG + Intronic
965924347 3:173958850-173958872 GCTCATTGGTGCCCAAAGTCTGG + Intronic
965984704 3:174736890-174736912 GCTTGTTGGTGCCCAAAGTCTGG + Intronic
966596376 3:181727472-181727494 TCTCTTAAGTACCCACAGTCGGG - Intergenic
967445955 3:189566642-189566664 AATCTTTGCTACTCAAAGTCCGG - Intergenic
968838383 4:2981897-2981919 GCTCATTGGTGTCCAAAGTCTGG + Intronic
970959600 4:21856919-21856941 GCTCCTCGGTGCCCAAAGTCTGG - Intronic
971876885 4:32319089-32319111 GCTCATTGGTGCCCAAAGTCTGG + Intergenic
972113418 4:35595188-35595210 CCCTTTTGGTACCCAACTTCAGG + Intergenic
974420095 4:61662502-61662524 GCTCATTGGCACCCAAAGTCTGG - Intronic
974607657 4:64173876-64173898 GCTCCTTGGCACCCAAAGTCTGG - Intergenic
975913614 4:79297679-79297701 GCTTATTGGCACCCAAAGTCTGG - Intronic
976129637 4:81870765-81870787 GCTCATCGGTGCCCAAAGTCTGG - Intronic
979010735 4:115365666-115365688 GCTCGTTGGTGCCCAAAGTCTGG - Intergenic
979364109 4:119800036-119800058 TCTCTTGGGTTCCTAAAGTCAGG + Intergenic
979637996 4:122978726-122978748 ACTCATTGGCACCCAAAGTCTGG + Intronic
980007542 4:127559229-127559251 GCTCATTGTTGCCCAAAGTCAGG - Intergenic
980312367 4:131147974-131147996 CATCTTTGCCACCCAGAGTCAGG - Intergenic
980703102 4:136457626-136457648 GCTCATAGGTGCCCAAAGTCTGG - Intergenic
981354962 4:143778284-143778306 CCCGTAGGGTACCCAAAGTCTGG - Intergenic
982568282 4:157015010-157015032 ACTTTCTGGTAGCCAAAGTCTGG + Intergenic
984325142 4:178241840-178241862 GCTCCTTGGTGCCCAAAGTCTGG - Intergenic
984763721 4:183383918-183383940 GCTCATTGGTGCCCAAAGTCTGG - Intergenic
984805696 4:183749341-183749363 CTTCTTTGGAACCCAAACTAAGG + Intergenic
989236524 5:39154453-39154475 CCTCATTTGTACTCAAAGGCAGG - Intronic
989339114 5:40354444-40354466 GCTTGTTGGCACCCAAAGTCCGG - Intergenic
991688298 5:69201911-69201933 CATCATTGTTACCCAAAGTCCGG - Intronic
992586453 5:78245047-78245069 CCCATAGGGTACCCAAAGTCCGG + Intronic
992662545 5:78975562-78975584 CCCCCTTGGTACCCAAGGTAAGG + Intronic
994753272 5:103764536-103764558 GCTCATGGGTCCCCAAAGTCCGG + Intergenic
994851196 5:105057192-105057214 GCTCATTGGCACTCAAAGTCTGG - Intergenic
995817568 5:116189093-116189115 CCTCTGTGGAAGCCAAAGTGGGG + Intronic
995942905 5:117606863-117606885 CCTCTTTGATTCCAAGAGTCAGG + Intergenic
996544718 5:124665885-124665907 CCTCTTTGGGGCCCAGAGTCTGG - Intronic
998825506 5:146097175-146097197 CATCTTTGGTACCACATGTCAGG - Intronic
1000100418 5:158011072-158011094 CCTCCTTGCTACTCAAAGTGTGG - Intergenic
1001594535 5:172889429-172889451 GGTCTTTAGAACCCAAAGTCTGG - Intronic
1004320623 6:14628845-14628867 CCTTTCTGGTCCCCAGAGTCCGG + Intergenic
1005417113 6:25611829-25611851 CCTCTCTGGTTAGCAAAGTCGGG + Intronic
1005594675 6:27368059-27368081 GCTCTTCAGTGCCCAAAGTCTGG - Intergenic
1005721674 6:28608400-28608422 CCCGTAGGGTACCCAAAGTCCGG - Intronic
1007649903 6:43412884-43412906 GCTCATTGGTGCCCAAAGTCTGG - Intergenic
1009859324 6:69306081-69306103 CCTCATGGGTACCCAAATCCAGG - Intronic
1012142065 6:95636640-95636662 GCTCGTTGGTGCCCAAAGTCTGG + Intergenic
1012169594 6:96002164-96002186 ACTTGTTGGTGCCCAAAGTCTGG + Intergenic
1013438629 6:110139052-110139074 GCTCATAGGCACCCAAAGTCTGG + Intronic
1014505381 6:122248218-122248240 GCTCATTGGTGCCTAAAGTCTGG + Intergenic
1016076802 6:139805338-139805360 GCTCATCGGTGCCCAAAGTCTGG + Intergenic
1017051477 6:150397922-150397944 CCTCTTTGCTGCCCAACTTCAGG + Intronic
1017373070 6:153735884-153735906 ACTTTTTGGCACCCAAAGTCTGG + Intergenic
1018289045 6:162271942-162271964 CTTCTCTGGTTCCCAAAGGCAGG + Intronic
1020586721 7:10078830-10078852 GCTCATTGGTGGCCAAAGTCTGG - Intergenic
1020649198 7:10854811-10854833 GCTCTTTGATGTCCAAAGTCTGG - Intergenic
1020959633 7:14786767-14786789 GCTCATTGGCACCCAAAATCTGG - Intronic
1021500825 7:21330234-21330256 GTTCATTGGTGCCCAAAGTCTGG + Intergenic
1021677614 7:23097223-23097245 GCTCTTTGGCGCCCAAAGTCTGG - Intergenic
1022391836 7:29950325-29950347 GCTCATTGATGCCCAAAGTCTGG - Intronic
1024857089 7:53794721-53794743 GCTTGTTGGCACCCAAAGTCTGG + Intergenic
1027687442 7:81295075-81295097 GCTCGTCGGTGCCCAAAGTCGGG + Intergenic
1027734982 7:81920703-81920725 TCTTGTTGGTGCCCAAAGTCTGG + Intergenic
1028401991 7:90434086-90434108 GCTCATTAGCACCCAAAGTCTGG + Intronic
1028974432 7:96895960-96895982 TTTCTGTGGTACCCAAAGACAGG - Intergenic
1030570231 7:111213303-111213325 GCTCATTGGCACCCAAAGCCTGG - Intronic
1031786520 7:126040687-126040709 GCTCATCGGTGCCCAAAGTCCGG - Intergenic
1031922018 7:127609172-127609194 ACTTGTTGGCACCCAAAGTCTGG + Intergenic
1037139335 8:15501318-15501340 CCTTCTTGGAACCCAAAGTTTGG + Intronic
1037945169 8:22985114-22985136 CCCATAGGGTACCCAAAGTCTGG + Intronic
1038340667 8:26682734-26682756 CCTCTTTCACACCCACAGTCTGG - Intergenic
1039062349 8:33581729-33581751 CCTCTCTGGTTCCCAAGGACAGG + Intergenic
1039220996 8:35330702-35330724 ACTCTATGGTAATCAAAGTCAGG - Intronic
1043180692 8:77083371-77083393 CCTCTTCAGTGCTCAAAGTCTGG + Intergenic
1044410916 8:91881704-91881726 CTTCTTTGGAACCCAAAAGCTGG - Intergenic
1045278291 8:100726434-100726456 GACTTTTGGTACCCAAAGTCAGG - Intergenic
1045300781 8:100908347-100908369 GCTCGTTGGCACCCAAAGTCTGG + Intergenic
1047057982 8:121189156-121189178 CAACTGTAGTACCCAAAGTCTGG + Intergenic
1052424865 9:28291210-28291232 CTTCTTTGGAACCCAAACTAAGG + Intronic
1052707509 9:32010928-32010950 GCTCGTAGGCACCCAAAGTCTGG - Intergenic
1056593411 9:87984170-87984192 CCCGTAGGGTACCCAAAGTCCGG + Intergenic
1058077605 9:100667144-100667166 GCTCTTTGGCACCCAAAGTCTGG - Intergenic
1059401166 9:114071402-114071424 GCTTGTTGGCACCCAAAGTCTGG - Intronic
1061267303 9:129514296-129514318 GCTCGTTGGTGCCCAAAGTCTGG - Intergenic
1188434832 X:30148371-30148393 GCTCCTAGGTACCTAAAGTCTGG - Intergenic
1188615991 X:32159806-32159828 TGTCTTTGCTACCCAAAGTATGG + Intronic
1188756456 X:33969227-33969249 GCTCCTTGGTACCCAAAGTCTGG - Intergenic
1188781730 X:34294435-34294457 TCTCTTTGCTATGCAAAGTCTGG + Intergenic
1190556057 X:51637016-51637038 CCAGTAGGGTACCCAAAGTCTGG - Intergenic
1192356039 X:70405016-70405038 CCATTTTGGTACCCAAAATGAGG - Intronic
1195178583 X:102334315-102334337 GCTCGTCGGTGCCCAAAGTCTGG - Intergenic
1195180281 X:102352768-102352790 GCTCGTCGGTGCCCAAAGTCTGG + Intergenic
1195281660 X:103340595-103340617 TCTCTTTGGTAACCAAAGAAAGG + Intergenic
1195295217 X:103469896-103469918 CCCGTAGGGTACCCAAAGTCCGG + Intergenic
1197378336 X:125709573-125709595 GCTCTTTGGCATCCAAAGTCAGG - Intergenic
1199609874 X:149604207-149604229 CCCCTCTGGTACCGAAAATCAGG - Intronic
1201346831 Y:12993896-12993918 CATGTAGGGTACCCAAAGTCTGG + Intergenic