ID: 1118523236

View in Genome Browser
Species Human (GRCh38)
Location 14:66611019-66611041
Sequence GAAAGTGCACAGATGGGCCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 480
Summary {0: 4, 1: 32, 2: 61, 3: 96, 4: 287}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118523236 Original CRISPR GAAAGTGCACAGATGGGCCT AGG Intronic
900755837 1:4433997-4434019 GAGAGTGCTGAGAAGGGCCTGGG + Intergenic
900812571 1:4818275-4818297 GGAAGTGCACAGATGGGCCAAGG + Intergenic
900842944 1:5070461-5070483 GGAAGTGCACAGATGGGCCTAGG - Intergenic
900883859 1:5401814-5401836 GGAAGTGCACAGATGGGCCTAGG - Intergenic
900913692 1:5619853-5619875 GAAAGTGTACAGAGGGGCCTAGG + Intergenic
900979842 1:6040137-6040159 GAAAGTACACAGATGCCCCCTGG + Intronic
901746462 1:11376983-11377005 TCAAGTGCACAGATGGACCTGGG - Intergenic
903989068 1:27252534-27252556 CAAAGTGCTGAGATGTGCCTGGG - Intronic
904588745 1:31595577-31595599 GGAAATGCTCAGATGGGCTTAGG - Intergenic
905640748 1:39588156-39588178 GGAAGTGCACGGATTGGCCTAGG - Intergenic
905753101 1:40483520-40483542 GAAAGTGTACAGTTTGGGCTGGG - Intronic
906348414 1:45036185-45036207 GAAGTTGCACTGATGGGCCTGGG - Exonic
907650111 1:56286827-56286849 CAAAGAGCACAGATAGGCCTAGG + Intergenic
908395856 1:63725161-63725183 GGAAGTGTACAGATGGGCCTAGG - Intergenic
909611026 1:77552001-77552023 GGAAGTGCACAGATGGGCCTAGG - Intronic
910526215 1:88181546-88181568 GATAGTGCACAGATGTTGCTCGG - Intergenic
911416440 1:97581006-97581028 GGAAGTACACAGGTGGGCCTTGG + Intronic
911511982 1:98818099-98818121 GAAAGGGCACAGATGGACAAGGG - Intergenic
915590408 1:156867242-156867264 GAATGTGGGCAGATGTGCCTTGG - Intronic
916217506 1:162410027-162410049 GGAAGTACACAAATGGGCCTTGG - Intronic
916435049 1:164770236-164770258 TAAAGAGCAGAGATGGGTCTGGG - Intronic
916721627 1:167488657-167488679 GAAAGTACACAGATGGGCCTAGG + Intronic
916738482 1:167628983-167629005 GAAAGTGCAAAGATGGTGCCGGG + Intergenic
917489734 1:175487966-175487988 GAGTGTGCTCAGGTGGGCCTTGG + Intronic
918210792 1:182349317-182349339 GTAAGCACACAGCTGGGCCTGGG - Intergenic
918732105 1:188012086-188012108 GAAAGTACATAGATCGGTCTAGG + Intergenic
918983138 1:191589128-191589150 GGTAGTGCACAGATGAGTCTAGG + Intergenic
920055883 1:203191363-203191385 GGAAGTGCACAGATGGGCCTAGG - Intergenic
920719252 1:208371715-208371737 GAAAGAGCAAGGATGGGTCTTGG - Intergenic
922207361 1:223460097-223460119 GAAAGAGCCAAGATGGGCCAGGG + Intergenic
922232572 1:223699670-223699692 GGAAGTGCACAGATGGGCCTAGG - Intergenic
922369594 1:224896057-224896079 GTAAGTGCACAGATAGGCTTAGG + Intergenic
922599536 1:226839041-226839063 GAAGGTGCACAGATGGGCCTAGG + Intergenic
922767553 1:228163743-228163765 GCAAGTGCACAGATGGGCCTAGG - Intergenic
922818214 1:228466306-228466328 GAAAGTGCACAGATGGACCCAGG - Intergenic
922822797 1:228495403-228495425 GAAAGGGCAAAGAGGGCCCTAGG + Exonic
923041349 1:230322178-230322200 GAAAGTGCCCAGATCTGCCTGGG + Intronic
924181981 1:241447893-241447915 AAAAGTGGACACCTGGGCCTTGG - Intergenic
924505876 1:244683253-244683275 GTACGTGTACACATGGGCCTAGG + Intronic
924669129 1:246105229-246105251 TAAAATGCACAGATGGGCCCTGG + Intronic
924727071 1:246681002-246681024 GAAAGAGACCAGATGGACCTTGG - Intergenic
924809892 1:247391736-247391758 GGAAATGCACAGATGGGTCTAGG - Intergenic
1063974219 10:11402345-11402367 GGAGGTGTACAGATGAGCCTCGG - Intergenic
1064087054 10:12353030-12353052 GAAAGTACACAGAGGCGGCTGGG - Intronic
1065683706 10:28263292-28263314 GAATGTGACCTGATGGGCCTGGG + Intronic
1066443595 10:35461559-35461581 GGAAGTGCACAGTTGGGCCCAGG + Intronic
1066515029 10:36149079-36149101 AAAAGTGCACATATGGCCCTGGG - Intergenic
1067250021 10:44578279-44578301 GGAAATGCACAGATGGGTCCAGG + Intergenic
1068070655 10:52190669-52190691 AAAAGTGCACAAATGGGCTTTGG - Intronic
1068139984 10:52993747-52993769 TGAAGAGCACAGATGGACCTAGG - Intergenic
1068243847 10:54339661-54339683 GGAAGTATACAGATGAGCCTAGG - Intronic
1068879034 10:62029112-62029134 GTGAGTGCACAGAGAGGCCTAGG + Intronic
1069473741 10:68715236-68715258 TTAAGTGCACAGGTGGGCCTAGG + Intergenic
1071223111 10:83492987-83493009 GAAAGTGCACAGATGGGCCTAGG + Intergenic
1071425019 10:85540617-85540639 GGAAGTGCATAGATGGGCCTGGG + Intergenic
1071586744 10:86830318-86830340 GGAAGTACACAGATAGGCCTGGG + Intronic
1071614842 10:87065994-87066016 CATAGTGAAAAGATGGGCCTTGG - Intronic
1072188849 10:93064771-93064793 AAACCTGCAAAGATGGGCCTAGG - Intronic
1072576434 10:96704808-96704830 TAATGTGCACAGAAGGACCTGGG - Intronic
1073053762 10:100686224-100686246 GAAAGTGCAGTGATGGTCCCAGG + Intergenic
1074047396 10:109851261-109851283 GAGAGTACATAGCTGGGCCTAGG - Intergenic
1074848058 10:117416252-117416274 GGAAGCACACAGATGGGCCTAGG + Intergenic
1075121668 10:119669147-119669169 GGAAGTGCACAGATGGGCCTAGG + Intronic
1075624768 10:123954298-123954320 GGAAGTGCACAGACGGGCCGAGG + Intergenic
1075665040 10:124223935-124223957 GGAAGTGCACAGGAAGGCCTGGG - Intergenic
1076358687 10:129871058-129871080 TAAAGCGAACAGATGGCCCTAGG - Intronic
1076581929 10:131517589-131517611 CACAGTGCCCAGCTGGGCCTGGG + Intergenic
1076687534 10:132204811-132204833 GAAAGGGCACAGATGGGCAGGGG - Intronic
1077958655 11:7049075-7049097 GACAGTGAACAGAAGGGCATTGG + Intronic
1078340744 11:10496580-10496602 GAAAGTGCTCTGATGGGCATGGG + Intronic
1079093699 11:17497557-17497579 GAAGCTGACCAGATGGGCCTGGG - Intronic
1080007395 11:27424509-27424531 GAAAGTGTGCATCTGGGCCTGGG - Intronic
1085040762 11:73325026-73325048 GAAGGTGGAGAGATGGGCCACGG + Intronic
1085344491 11:75759310-75759332 GCAAGTGACCTGATGGGCCTAGG + Intergenic
1086478698 11:87209272-87209294 GAAAGTAGACAGGTGGGTCTTGG - Intronic
1086899119 11:92346367-92346389 GAAAGTGCACACACGGGAATTGG + Intergenic
1087357890 11:97117930-97117952 GGAAGTACACAGATGGTCCTAGG + Intergenic
1087899600 11:103625928-103625950 GGAAGTGCACAGATGGGCAAAGG + Intergenic
1089395197 11:118132092-118132114 GAAAGTGAACACATGTGCTTAGG - Intergenic
1090244388 11:125205341-125205363 GAAAGAGCCCACCTGGGCCTGGG - Intronic
1090286760 11:125506346-125506368 GGAAGTGCACAGATTGATCTAGG - Intergenic
1091910560 12:4227189-4227211 GACAGTGCATAGTGGGGCCTGGG - Intergenic
1092255522 12:6924998-6925020 GAAAGTGGAGAGAAGGGCCTGGG - Intronic
1094122172 12:26986161-26986183 AGATGTGCGCAGATGGGCCTAGG - Intronic
1094364490 12:29665690-29665712 GAAAGTACACAGATGGGCCTAGG - Intronic
1094474088 12:30827967-30827989 GGATGTGCCCAGATGGGCCTTGG - Intergenic
1097387089 12:58962937-58962959 GGAGGTGCACAGATGGGCCTAGG - Intergenic
1098454724 12:70659247-70659269 GAAAGGGCACAGGTAGGCCATGG + Intronic
1098878392 12:75891188-75891210 GAAAGTACACAGATGAGCCTAGG - Intergenic
1099926752 12:89027917-89027939 GGAAGTGCACAGATGGGCCTAGG - Intergenic
1100751366 12:97701934-97701956 GGAAATGCACAGATGGGCCTAGG - Intergenic
1100763757 12:97839437-97839459 GGAAGTACACAGATGGGCCCAGG + Intergenic
1100950377 12:99842427-99842449 GGAAGTACACAGATGGGCCTAGG - Intronic
1101153840 12:101908779-101908801 GGAAGTGCACAGATGGACCTAGG + Intronic
1101880136 12:108620797-108620819 GGAAGTGCACAGATGGGCCTAGG - Intergenic
1102637480 12:114336756-114336778 GGAAGTACACAGATTGGCCCAGG - Intergenic
1104863218 12:131936266-131936288 GAAAGTGTACAGTTCGGGCTGGG + Intronic
1105828800 13:24145846-24145868 GACAGAGCACAGCTGGGGCTTGG + Intronic
1105927859 13:25023970-25023992 CAAAGTGCGCAGATAGGCGTTGG - Intergenic
1106332668 13:28753966-28753988 GGAAGTGCATAGAAGGCCCTAGG - Intergenic
1106825786 13:33518994-33519016 TAAAGTGCTCAGATGGGCCTAGG - Intergenic
1106948295 13:34853528-34853550 GGAAGTGCACAGAAAGGCCTAGG + Intergenic
1107502341 13:40993374-40993396 GGCAGTGCACCGATGGGTCTGGG + Intronic
1107792223 13:44014083-44014105 TCAAGTGCACAGATGTGCTTAGG - Intergenic
1107963355 13:45578044-45578066 GGAAGTGCACAGATGGACCTAGG - Intronic
1107966194 13:45600313-45600335 GGAAGTGCACAGATGAATCTGGG - Intronic
1108481243 13:50874146-50874168 GGAAGTGCCCAGATGGGGCTAGG + Intergenic
1108700237 13:52937537-52937559 AAAAGAGCCCAGATGGACCTTGG + Intergenic
1109627595 13:64995733-64995755 GGAAGTGCAAAGATGGGCCTAGG + Intergenic
1110455552 13:75686618-75686640 GAATGTGTACAGAAGGGTCTAGG + Intronic
1110829171 13:80010886-80010908 GAATATGCACAGATGAGCATAGG - Intergenic
1110893271 13:80716457-80716479 GGAAGTACAGAGATGGGCCTAGG + Intergenic
1111101989 13:83599934-83599956 GAAAATGCAGAGAAGGGCCCGGG + Intergenic
1112278710 13:98044314-98044336 GCAAGTGCAGAGATGGGCCTAGG + Intergenic
1114377611 14:22164979-22165001 GAAAATGTACAGATGAGCTTAGG + Intergenic
1116189794 14:41649537-41649559 TGAAGTGCACAGATGGGCCTAGG - Intronic
1116381776 14:44277625-44277647 GAAAGTCCATAAATGGGCCCAGG - Intergenic
1117626727 14:57647692-57647714 GGAAGAACACAGATGGGTCTAGG - Intronic
1118105878 14:62658851-62658873 AAAAGTTGACAGATGGGACTTGG + Intergenic
1118523236 14:66611019-66611041 GAAAGTGCACAGATGGGCCTAGG + Intronic
1119199891 14:72744480-72744502 GAAAGTGGGGAGCTGGGCCTGGG - Intronic
1119928934 14:78525519-78525541 GGCAGTGCACAGATAGGGCTGGG - Intronic
1119962078 14:78870178-78870200 GGAAGTGCACAGATGAGCCTAGG + Intronic
1120280217 14:82429741-82429763 GGGAGTTCACAGATGGGCCAAGG + Intergenic
1121808649 14:96857592-96857614 GAAGGAGCAAGGATGGGCCTAGG + Intronic
1122231823 14:100309945-100309967 GAGAGTGCACAGAAGGGCTCTGG + Intergenic
1122717185 14:103702769-103702791 GGACGTGCACAGATGGGCCTAGG - Intronic
1123003999 14:105312730-105312752 CCAAGTGCACAGATGTCCCTTGG - Exonic
1126901727 15:53321477-53321499 GGAAATGCACAGATGGGCCCAGG - Intergenic
1127971873 15:63968254-63968276 GAAGTTGCCCAGGTGGGCCTAGG + Intronic
1128480323 15:68032005-68032027 GAAAGTGCATGGATGGGCTTAGG - Intergenic
1128820703 15:70650187-70650209 GGAAGTGCACAGATGGGCCTAGG + Intergenic
1129141941 15:73606845-73606867 GGAAGTTCACAGATGGGCCTAGG - Intronic
1130079752 15:80722268-80722290 AAAAGTGAACAGATGGGCTCAGG + Intronic
1130320658 15:82838060-82838082 GAGAGTGCACAGCAAGGCCTGGG + Intronic
1130557547 15:84933376-84933398 AAAAGTGGAGAGATGGGCCCAGG - Intronic
1132142209 15:99405426-99405448 GGAAATGCAAAGATGAGCCTAGG + Intergenic
1132644085 16:990836-990858 GGCAGTGCCCAGATGGGCCCAGG + Intergenic
1132662864 16:1069352-1069374 CAGAGTGCACAGAGGTGCCTAGG + Intergenic
1133456407 16:5946170-5946192 GAAAGTGCACAGACGGCCCGAGG + Intergenic
1135054713 16:19221279-19221301 GGTGGTGCACTGATGGGCCTAGG + Intronic
1136298597 16:29318121-29318143 GAAAATGCACAGATGGGTGCAGG - Intergenic
1138761597 16:59550425-59550447 GGAAATGCACAGATGAGCCTAGG + Intergenic
1139280980 16:65770294-65770316 CCAAGGGCACAGATGAGCCTAGG - Intergenic
1139823790 16:69741078-69741100 AAAAAAGCACAGATGGGGCTGGG + Intergenic
1141155016 16:81591379-81591401 GACAGTGCACAGAAGGTACTGGG + Intronic
1141644625 16:85360594-85360616 GGCAGTGCACAGCTGGGCCCGGG - Intergenic
1142025572 16:87811250-87811272 GAAAATGAATAGATGGGCCCGGG - Intergenic
1142025710 16:87812386-87812408 GAAAATGAACGGATGGGCCCGGG + Intergenic
1142414144 16:89932289-89932311 GCAGCTGCACAGCTGGGCCTGGG + Intronic
1143338594 17:6191819-6191841 GAAAGCCCACAGAGGGTCCTTGG - Intergenic
1143392769 17:6569806-6569828 GAAACTGCACAGAAGGGGCTGGG + Intergenic
1143508370 17:7381913-7381935 GGAAGGACACAGATGAGCCTGGG + Intronic
1143771090 17:9169452-9169474 GAATGAGCACAGCTGGGCCAGGG - Intronic
1144220761 17:13097770-13097792 GAAAGCGCATAGATGGGCCTAGG + Intergenic
1144344818 17:14340176-14340198 GGAAGTGCACAGGAGGTCCTGGG - Intronic
1144588201 17:16501747-16501769 GGAAGTGCACAGATGGGCCTAGG - Intergenic
1144711357 17:17403665-17403687 GAAAATGCACGGAGGAGCCTGGG + Intergenic
1145106781 17:20124314-20124336 GAAAATGAACAGACTGGCCTTGG + Intronic
1145901295 17:28491972-28491994 CCAAGTGCACAGAGGGGCTTTGG - Intronic
1147685558 17:42284818-42284840 GTAAGTGCACAGATGGCACCAGG - Intergenic
1150306906 17:64093380-64093402 GAAACTGAACAGATGGGGCCAGG - Intronic
1150760811 17:67959226-67959248 GAAAGAGCCCAGATGGGACAGGG + Intronic
1151415049 17:73956730-73956752 GATGGTGCTCAGCTGGGCCTGGG - Intergenic
1151668016 17:75556661-75556683 GCAGGGGCACAGAAGGGCCTAGG - Intronic
1152281156 17:79385546-79385568 GAGAGTTCTCAGATGGGCATGGG - Intronic
1152408737 17:80111585-80111607 GGAAGTACAAGGATGGGCCTGGG + Intergenic
1153095329 18:1394784-1394806 GGAAGAGCACGGATGGGACTAGG + Intergenic
1153354584 18:4121383-4121405 GGAAGTGCCTGGATGGGCCTAGG - Intronic
1153944233 18:10004630-10004652 GGAAATGCACATATGGGTCTAGG - Intergenic
1154093524 18:11387739-11387761 GAAATTTCAGAGATGAGCCTGGG - Intergenic
1156331558 18:36128906-36128928 TAAGGTGCTCAGATGGGCTTCGG - Intronic
1156353403 18:36321262-36321284 ACAAGAGCACAGATGGGCCCTGG - Intronic
1157203882 18:45682289-45682311 GAAAGAACACAGATAAGCCTTGG - Intronic
1158094853 18:53758746-53758768 GGAAGTGCAGAAATGGGCCTAGG + Intergenic
1158447942 18:57537348-57537370 TAAAGAGCACAGCTGGGGCTGGG - Intergenic
1159140916 18:64393173-64393195 GGAAGTTCACAGATGTGCCTAGG - Intergenic
1159507452 18:69355785-69355807 GGAAATGCACAGATGGGCCTAGG - Intergenic
1159821731 18:73154416-73154438 GGAAGGGCAGAGAAGGGCCTGGG - Intronic
1160006986 18:75075097-75075119 GATAGTGGGCAGCTGGGCCTCGG - Intergenic
1160621040 18:80170842-80170864 GCAAGTGCACAGATTGGACCTGG - Exonic
1161123314 19:2542054-2542076 GCAGGTGCACAGTCGGGCCTTGG + Intronic
1163035639 19:14567373-14567395 GCCAGTGCAGAGCTGGGCCTTGG - Intronic
1163407302 19:17130881-17130903 AGAAGTGCACAGATGGGACTGGG - Intronic
1164255489 19:23524621-23524643 GCCAGTGCACAGATGGGATTGGG - Intergenic
1165215796 19:34271541-34271563 GAAAGTGCACAGAAGGGGCCGGG - Intronic
1165232202 19:34394184-34394206 CAAGGAGCACAGATGGACCTTGG - Intronic
1165682763 19:37791545-37791567 TGAAGTGTACAGATGGGCCCAGG + Intronic
1165722152 19:38087097-38087119 GGAGGTGCACAGATGGGCCTAGG + Intronic
1166125295 19:40711765-40711787 GTAAGTGCACAGAAGGCACTGGG - Intronic
1166351069 19:42198594-42198616 GAAAGGGCATAGGTGGGCATCGG - Exonic
927462300 2:23309777-23309799 GACAGTGAGCAGCTGGGCCTGGG - Intergenic
927893466 2:26766716-26766738 GAAAGGGCAGAGCAGGGCCTGGG - Intronic
929247444 2:39718410-39718432 GAATATCCACAGCTGGGCCTAGG + Intergenic
929580575 2:43079541-43079563 GAAGGTGCATGGATGGGACTAGG + Intergenic
929692225 2:44084560-44084582 GGAAGTATACAGATGGGCCTAGG - Intergenic
929816427 2:45236559-45236581 GAAAGTGTACTAAGGGGCCTGGG + Intergenic
929947058 2:46379750-46379772 GAGAGTCCACAGATGGACCTGGG + Intronic
930273824 2:49288241-49288263 GGAAGTGCACAGATGGGCTTGGG + Intergenic
930570119 2:53075980-53076002 GAGAGTGTGCAGATGGGCCCTGG - Intergenic
931804042 2:65787743-65787765 GGAAGTGTACAGATGGACTTAGG - Intergenic
932344636 2:70987611-70987633 AAGAGTGCACAGACGGGCCAGGG + Exonic
932601429 2:73129213-73129235 GGAAGTGCACAGGTGGGCCTAGG - Intronic
932986792 2:76736133-76736155 GGAAGTATACATATGGGCCTAGG - Intergenic
933373907 2:81454021-81454043 GAAAGTGCACAAATGTCCTTTGG + Intergenic
935390168 2:102542664-102542686 GGAAGTACACAAACGGGCCTTGG + Intergenic
935736262 2:106108863-106108885 GGAAGTGCACAAATGGGCCTAGG - Intronic
936476815 2:112846728-112846750 GAAAGTGTACAAATGTGCCTGGG - Intergenic
936480911 2:112884041-112884063 GTAAGTCCACAGATAGGTCTTGG + Intergenic
937152428 2:119695204-119695226 GAATGTGGACAAATGGGACTGGG + Intergenic
937816894 2:126260564-126260586 GGAAGTGGACAGATAGGCATAGG + Intergenic
938182874 2:129199543-129199565 GGAAGTACACAGATGGGCCTAGG - Intergenic
938241082 2:129742671-129742693 GCAAGTGCTCAGCTGGGACTGGG - Intergenic
938337485 2:130512355-130512377 GGACGTGCACAGATGGACGTAGG - Intergenic
938352353 2:130608380-130608402 GGACGTGCACAGATGGACGTAGG + Intergenic
938977608 2:136494740-136494762 GAAGGTGCACCGAGGGGCCTGGG + Intergenic
939254301 2:139722560-139722582 GTAAATGCACAGATGGGCTTAGG - Intergenic
945067828 2:205961957-205961979 GAAAGTGCACAGACGGGCCTAGG - Intergenic
945356104 2:208841438-208841460 GGAAATGCACAGTTGGGCTTAGG + Intronic
945807505 2:214508266-214508288 AAAAGTGCACAGAAGAGCCGGGG - Intronic
946402033 2:219473223-219473245 GGAAGTGTACAGATGGGCCAAGG - Intronic
946494739 2:220184476-220184498 GGAAGTACACAGATGGGCCTGGG - Intergenic
947123806 2:226845549-226845571 GAAAGTAAAGAGATGGGCTTTGG - Intronic
948433455 2:237935751-237935773 GGAAGTGCACAGAGGGGCCCAGG - Intergenic
948440439 2:237983794-237983816 GAAAGAGCACAGAGGGTCCAAGG - Intronic
948751840 2:240137609-240137631 TGCAGTGCACAGATGGGCCTGGG - Intergenic
948807866 2:240460757-240460779 GTAGGGGCACAGGTGGGCCTTGG - Intronic
1169442436 20:5643865-5643887 GAAAGAGCAGAGATGTGGCTGGG - Intergenic
1169578459 20:6992147-6992169 GAAAGTGCAGGGACGGGCGTTGG + Intergenic
1169981134 20:11385177-11385199 GAAACTGCTCAGATGGGGCAAGG - Intergenic
1170982386 20:21226822-21226844 AAAACTGCCCAGGTGGGCCTCGG + Intronic
1171462816 20:25308565-25308587 GAAAGTGCTCAGAGGAGCCATGG + Intronic
1171969114 20:31552306-31552328 GAAGGTGCATGGAGGGGCCTGGG + Intronic
1172437098 20:34937029-34937051 GAAAGAGCACAGGTGGCCCGAGG + Intronic
1173002605 20:39115379-39115401 GAATGTTCATAGGTGGGCCTGGG - Intergenic
1173447626 20:43134298-43134320 GGAAGTACACAGATGGGCCAAGG - Intronic
1173720658 20:45254761-45254783 GAAAGGGAAGAGATTGGCCTGGG + Intergenic
1174350543 20:49964404-49964426 AAAAAGGCAAAGATGGGCCTGGG - Intergenic
1174736708 20:52972178-52972200 GAGGGCGCACAGAGGGGCCTGGG + Intergenic
1176176815 20:63731381-63731403 TAAAGTGTACAGTTGGCCCTTGG + Intronic
1176176819 20:63731436-63731458 TAAAGTGTACAGTTGGTCCTTGG + Intronic
1176176826 20:63731538-63731560 TAAAGTGTACAGTTGGCCCTTGG + Intronic
1176176830 20:63731591-63731613 TAAAGTGTACAGTTGGCCCTTGG + Intronic
1176176840 20:63731738-63731760 TAAAGTGTACAGTTGGCCCTTGG + Intronic
1177198161 21:17924456-17924478 GAAAGTGCACAGCTGCTCCATGG - Intronic
1177297084 21:19189106-19189128 GAAGGTGCAGAGGTGGGCCCAGG + Intergenic
1177760226 21:25394924-25394946 GAAAGTGCACAGATAGGCCTCGG - Intergenic
1178664187 21:34532289-34532311 GGAAGTGCACAGGTGAGCCTAGG + Intronic
1179569936 21:42272823-42272845 GAAGGAGCAGAGAGGGGCCTGGG - Intronic
1179958405 21:44754081-44754103 GAAAGTCAAGAGATGGGCCCAGG + Intergenic
1180800435 22:18629354-18629376 GGAAGTGCTCAGATGTGCCTAGG + Intergenic
1180851670 22:19024910-19024932 GGAAGTGCTCAGATGTGCCTAGG + Intergenic
1181221284 22:21365908-21365930 GGAAGTGCTCAGATGTGCCTAGG - Intergenic
1182226286 22:28800966-28800988 GATAGAGCGCAGTTGGGCCTTGG + Intergenic
1183367595 22:37415402-37415424 GAAAGTGCACACACAGGCCCTGG + Intronic
1183420779 22:37710197-37710219 GAGTGTACACATATGGGCCTTGG - Intronic
1183472734 22:38018158-38018180 GAAAGTTCACAGATGAGCCCTGG - Intronic
1183708655 22:39489865-39489887 GACAGTGGACAGCTGGGACTGGG - Exonic
1184612275 22:45612359-45612381 GAAACTGCAGAAATCGGCCTAGG - Intergenic
1184910309 22:47527692-47527714 GAAAGCACACAGATGGGCCTAGG + Intergenic
1184910833 22:47532885-47532907 GGAAGTGCACAGATGGGGCTAGG + Intergenic
1184965142 22:47966038-47966060 GGAAGTGCACAGGTGGGTCTGGG - Intergenic
1185405098 22:50643183-50643205 GGAAGTGCACAGATGGGCTCCGG - Intergenic
949455643 3:4235659-4235681 GAATGTCCAGAGAAGGGCCTAGG - Intronic
949915873 3:8964078-8964100 GGAAGTACACAGATTGGCCTAGG - Intergenic
950207517 3:11092160-11092182 GAGAGGGCAGAGCTGGGCCTGGG + Intergenic
950487067 3:13280170-13280192 GGAAGTGCAGGGCTGGGCCTAGG + Intergenic
950924799 3:16729697-16729719 GGAAGTGCACAGATGGGCCCTGG + Intergenic
951591242 3:24267503-24267525 GGAAGTGCATAGATGAGCCCAGG - Intronic
954534631 3:51350205-51350227 GACAGTGTCCAGTTGGGCCTGGG + Intronic
956706933 3:72007221-72007243 GGAAGTACACAGATGGGGCCAGG - Intergenic
957415688 3:79900437-79900459 GGAAGTGCATAGAAGTGCCTAGG + Intergenic
957782252 3:84834626-84834648 GGAAGTGCAAAGGTGGACCTAGG + Intergenic
958441172 3:94157803-94157825 GAAAGTGCTCTGTTGGGCCCTGG + Intergenic
958445857 3:94214070-94214092 GGAAGTACAAAGATGGGCCTAGG + Intergenic
958979837 3:100708578-100708600 GAAGATGCACAGATGGTCCTAGG - Intergenic
959052904 3:101541361-101541383 AGAAGTGCACAGATGGGCTCAGG + Intergenic
959154331 3:102648388-102648410 GGAAATGCACAGGTGGGCTTAGG - Intergenic
959980902 3:112516552-112516574 GGAGGTGCACAGATGGGCCTAGG - Intergenic
960154884 3:114289933-114289955 GGAAGTGCATGGATGGGCCTAGG - Intronic
960628010 3:119700529-119700551 GAAAGTACACAGACAGACCTAGG + Intergenic
961350217 3:126295701-126295723 GGAAGTGCACAGATGGGTCAAGG - Intergenic
961386997 3:126528450-126528472 GGTAGTGCACTGGTGGGCCTTGG + Intronic
963774410 3:149423403-149423425 GGAAATACACAGATGGGCCTAGG + Intergenic
963790769 3:149580345-149580367 GAAAGTGTGCATCTGGGCCTGGG - Intronic
964345293 3:155749064-155749086 GAAAACGCACATATGGGCCCAGG + Intergenic
964979548 3:162662566-162662588 TGAAGTGCACAGATGTGCTTAGG + Intergenic
965463115 3:168993450-168993472 GGAAGTGCACAGATGGGCCTAGG - Intergenic
965681853 3:171259975-171259997 GGAAGTGCATAGATGGGCCTAGG - Intronic
965738489 3:171847908-171847930 GAAAGTACACAGATGGGCCTAGG + Intronic
965888705 3:173482438-173482460 GAAAGTGTGGAGATGGGGCTGGG - Intronic
966119232 3:176503890-176503912 CAAAGTACACACATGGGCCAAGG + Intergenic
966225620 3:177594341-177594363 GGAAATGCACAGATAGGCCTAGG + Intergenic
966238480 3:177728658-177728680 GGAAGTGCACAGACAGGCCTAGG + Intergenic
966942950 3:184758422-184758444 AAATGTGCACAGAAGGGTCTGGG - Intergenic
968603871 4:1522405-1522427 GACAGAGGACAGGTGGGCCTTGG - Intergenic
969368715 4:6716685-6716707 GAAGGTGCCCAGCTCGGCCTCGG - Exonic
969527978 4:7713740-7713762 GGAAGTGCTCAGATGGGCCTAGG + Intronic
969850072 4:9948970-9948992 GGAAGTACACAGATGGGCCTAGG - Intronic
970471258 4:16381471-16381493 GGAGGTACACAGATGGGCCTAGG + Intergenic
970471931 4:16387590-16387612 GAAAGTGCATAGATGAGCCTAGG - Intergenic
970921945 4:21404948-21404970 GGAAGTGCACAGATAGGCCTAGG - Intronic
971755453 4:30702093-30702115 GGAAGTTCACTGATGGTCCTCGG - Intergenic
974250235 4:59375895-59375917 GAACATGCAGAAATGGGCCTTGG - Intergenic
975758784 4:77597718-77597740 GGAAGTGCACAAATGGCTCTTGG + Intronic
976266329 4:83188899-83188921 GGAAGTACAGAGATGGGCCTTGG + Intergenic
976332979 4:83852960-83852982 GAAAGTGCACAGATGGGCCTAGG - Intergenic
977673367 4:99721083-99721105 GAAAGATCTGAGATGGGCCTTGG - Intergenic
977993679 4:103476422-103476444 GGAAGTGCACAGATGAACCTAGG + Intergenic
979129653 4:117026458-117026480 TGAAGTGCACAAATGGGCCCAGG + Intergenic
979525012 4:121707300-121707322 AGAAGTGCACACGTGGGCCTAGG + Intergenic
979689200 4:123542829-123542851 GGAAGTGCACAGATGGGCCTAGG - Intergenic
980197090 4:129603309-129603331 GCAAGTTCACAGATGGTCCTAGG - Intergenic
980459066 4:133081719-133081741 AGAAGTGCACATATGGGCATAGG - Intergenic
980653809 4:135756142-135756164 GAAAGTGCATAGGTAGGCCTAGG + Intergenic
980933019 4:139199413-139199435 GGAAGTACACAGATGAGCCTAGG - Intergenic
981750698 4:148090545-148090567 GCAGGTTCACAGATGTGCCTGGG - Intronic
982022649 4:151219107-151219129 GGAAGTACACAGATGGGACTAGG - Intronic
983082359 4:163402253-163402275 GGAAGTATACAGATGGGCCTAGG + Intergenic
983426401 4:167589205-167589227 GGAAGTGCACATATGGACTTAGG + Intergenic
984719882 4:182959638-182959660 GGAAGTACACAGATGGGCCTAGG + Intergenic
985735394 5:1577164-1577186 GACAGTAGCCAGATGGGCCTAGG - Intergenic
986613679 5:9594720-9594742 GGAAGTGCACAGATGGGCCCAGG + Intergenic
987027523 5:13942500-13942522 GGAAGTGTACAGATGGGCCTAGG - Intronic
987259786 5:16191804-16191826 GGAAGTGCACAGATGGGCATAGG - Intergenic
987683463 5:21166463-21166485 AAGAGTGCACAAATGGACCTAGG - Intergenic
988602558 5:32653563-32653585 GGAAGTGTACAGACAGGCCTAGG - Intergenic
990276366 5:54201409-54201431 AGAAGTGCACAGATGGGTTTAGG - Intronic
991257811 5:64634351-64634373 GGAAGTACACAGATGGGCCTAGG + Intergenic
991403896 5:66283007-66283029 TAAACTGCACAAATGGGGCTAGG - Intergenic
993121726 5:83783318-83783340 TAAATTGCAGGGATGGGCCTGGG + Intergenic
993350171 5:86840609-86840631 GAAAGATAACAGATGAGCCTAGG + Intergenic
993953365 5:94202098-94202120 GGAAGTGCACAGATGGACCTAGG + Intronic
994688248 5:102983581-102983603 GAAAGTGTAGAGATGGGCAAAGG + Intronic
994865798 5:105268103-105268125 GGAAGTGCACAGATGAACGTTGG - Intergenic
995140019 5:108725376-108725398 GAAAGTATACAGACAGGCCTAGG + Intergenic
995283798 5:110364234-110364256 GCAAGTACACAGATGGGGCTAGG - Intronic
998616436 5:143745330-143745352 GAAAGGGCACAGATTGGACAGGG - Intergenic
999642127 5:153682426-153682448 AGAATTGCACAGATGGGCCTAGG - Intronic
1000447682 5:161344302-161344324 GAAAATACAGAGATGGGGCTAGG + Intronic
1000758138 5:165186065-165186087 TAAAGTGCACCGATTGGCTTAGG + Intergenic
1001299009 5:170520322-170520344 CTAAGGGCACAGACGGGCCTGGG - Intronic
1001330761 5:170760765-170760787 GAAAATGCACAGATGGACCTAGG - Intergenic
1001457029 5:171871280-171871302 GAAAGAGCACAGATGAGACAAGG + Intronic
1002130168 5:177076365-177076387 GGAAGTGCACAGATGGACCTAGG - Intronic
1002272521 5:178082022-178082044 GGAAGCACACAGATGGGTCTAGG - Intergenic
1002834635 6:855755-855777 GAACGTGCAGAAATGTGCCTAGG - Intergenic
1002875308 6:1204633-1204655 GGAAGTGCACGGATGGGCTTAGG + Intergenic
1003092017 6:3112278-3112300 GAAAGTGAACTGTTGGGCCGGGG + Intronic
1003183822 6:3813571-3813593 CAAAGTGCACAGAATGGCGTGGG + Intergenic
1005214960 6:23515145-23515167 GGAAGTGCACAGATGGACCTAGG - Intergenic
1005512938 6:26528418-26528440 CAACGTCCAGAGATGGGCCTAGG - Intergenic
1005577635 6:27205077-27205099 GGAAGAACACAGATGGGCCCTGG - Intergenic
1006387646 6:33740287-33740309 GGAAGTGGACAGATGGCCCCAGG + Intronic
1007279251 6:40698348-40698370 GAAGGTGTACGGATGGGCTTGGG - Intergenic
1007279257 6:40698386-40698408 GAAGGTGTACAGATGGGCTTGGG - Intergenic
1007340494 6:41188321-41188343 GAAAGTGTCCAGTTGGGGCTGGG + Intergenic
1008099525 6:47376506-47376528 GAAAGGGCATGGATGGGCTTTGG - Intergenic
1008157195 6:48031086-48031108 GAAAGTGCACAGATTAGCCTAGG - Intronic
1008373101 6:50758894-50758916 GGAAATGCAAAGATGGGCCTAGG + Intronic
1009622895 6:66098277-66098299 GGAAGTGCACAGATGGGACGAGG + Intergenic
1010004816 6:70984102-70984124 GGAAGTGCACAGATGGGCCTAGG + Intergenic
1010427540 6:75743748-75743770 GGAAGGACACAGATGGACCTAGG + Intergenic
1010508829 6:76692154-76692176 GGAAGTGCACAGATGGGCCTAGG + Intergenic
1011543816 6:88463204-88463226 GAAGGAGCACAGATGGTTCTGGG + Intergenic
1011990150 6:93504830-93504852 GACAGTGCACATCTGGGGCTTGG - Intergenic
1012682268 6:102196999-102197021 GAAATTTTACAGCTGGGCCTTGG + Intergenic
1013460254 6:110367793-110367815 GAAAATGCACAGTTGGGCAATGG - Intergenic
1015978878 6:138818932-138818954 GGAAGTGCACAGGTGGGCCAAGG + Intronic
1015996402 6:138999260-138999282 GGAAGTGCACAGATGGGCCTAGG - Intergenic
1016443541 6:144109343-144109365 GGAAGTGCACAGATGGGCCCAGG + Intergenic
1017620112 6:156287823-156287845 TAAAATGCACATATGGGGCTGGG + Intergenic
1017995367 6:159527560-159527582 GCCACTGCACACATGGGCCTGGG + Intergenic
1018650847 6:165990018-165990040 AAAGGTCCACAGATGAGCCTTGG - Intergenic
1018798771 6:167207036-167207058 GAAAATGCACAGCTCGGCGTGGG + Intergenic
1019465420 7:1185564-1185586 GAAAGTCCACGGAGGGGCCGTGG - Intergenic
1020591112 7:10138397-10138419 GGAAGGGCATATATGGGCCTAGG - Intergenic
1022159589 7:27695769-27695791 GGAAGAGCATAGATGGGCCTAGG + Intergenic
1022378841 7:29841029-29841051 GGGAGTGCACAGATGGGCCTGGG + Intronic
1023829355 7:44029797-44029819 GAAGGTGCCCTGGTGGGCCTTGG - Intergenic
1024056731 7:45664186-45664208 GGAAGTGCACCGTTGGGCCTAGG + Intronic
1025006915 7:55362696-55362718 GGAAGTGTGCAGATGGGCCTTGG + Intergenic
1025963449 7:66245569-66245591 AGAAGTGCACAGATGGTCCTAGG + Intronic
1027671585 7:81105903-81105925 GAATGTGTACAGATGGGCCTAGG + Intergenic
1027796953 7:82707602-82707624 GAAAATAGACTGATGGGCCTTGG + Intergenic
1028137017 7:87232618-87232640 GGAAGTGCACAGATGAGCCTAGG + Intergenic
1029162580 7:98563216-98563238 GAAAATGCACAGAACAGCCTGGG - Intergenic
1029739661 7:102484055-102484077 GAAGGTGCCCTGGTGGGCCTTGG - Intronic
1029757662 7:102583234-102583256 GAAGGTGCCCTGGTGGGCCTTGG - Intronic
1029775598 7:102682295-102682317 GAAGGTGCCCTGGTGGGCCTTGG - Intergenic
1030785057 7:113650030-113650052 GGAAGTGCACAGATGGGCCTAGG - Intergenic
1031323653 7:120364870-120364892 AGAATTGCACAGATGGGCCTAGG + Intronic
1032292110 7:130597866-130597888 GAAAGTGCAGAAATTGGCTTTGG + Intronic
1033991048 7:147287422-147287444 GGAATTGCACAGATGGGCCTTGG + Intronic
1033993004 7:147311151-147311173 GAGAGTAAACAGATGGGCCTAGG + Intronic
1035241471 7:157533381-157533403 AGAAGGGCACAGATGGGACTAGG - Intergenic
1035299047 7:157885321-157885343 CACAGTGCCCAGGTGGGCCTGGG + Intronic
1035327243 7:158073096-158073118 GAGAGTGCAAAGATGGTGCTGGG - Intronic
1035607094 8:936967-936989 GAAAGTTCACACATAAGCCTAGG - Intergenic
1036151690 8:6305074-6305096 GGAAGTGCACAGATGGGCCTAGG + Intergenic
1036744905 8:11399875-11399897 GAAAGTACACAGATGAGCCTTGG + Intronic
1037622727 8:20579120-20579142 GGAAGTTCACAGAAGGGCCTAGG + Intergenic
1037623086 8:20584182-20584204 GTAAGTGCACAGAAGGGCTTAGG + Intergenic
1039733920 8:40309549-40309571 GGAAGTGCACAGATGGGCCTAGG - Intergenic
1039734246 8:40313877-40313899 GAAAGTGCACAGATGGGCCTAGG - Intergenic
1039849206 8:41347732-41347754 GGAAGTGCACTTATAGGCCTAGG + Intergenic
1041322331 8:56626168-56626190 GGAAGTGCAAAGATGGGCCTAGG - Intergenic
1041511746 8:58660404-58660426 GGAAGTGCACACAAGGACCTGGG + Intergenic
1042206798 8:66337724-66337746 GGAAGTGCACAGTTGGGCCTAGG - Intergenic
1042341507 8:67684728-67684750 GGAAATGGACAGATGGGCCTAGG - Intronic
1042584307 8:70318329-70318351 GGAAGTACACAGATGAGCCTAGG - Intronic
1043342277 8:79254674-79254696 AGAAGTGCATAGATGGGCCCAGG + Intergenic
1043631250 8:82337477-82337499 GCAGGTACACAGATGAGCCTTGG - Intergenic
1044510323 8:93069947-93069969 GGAAGTGCACAGATGGGCCTAGG - Intergenic
1045848660 8:106666853-106666875 GGAAGTGAACAGATTGGCATAGG + Intronic
1047441799 8:124885239-124885261 GGAAGTGCACAGATGGGCCTAGG + Intergenic
1047756469 8:127922763-127922785 GGAAGTAAAGAGATGGGCCTGGG - Intergenic
1047757241 8:127928084-127928106 GGAAGTACACAGATGGGCCTAGG - Intergenic
1048567324 8:135615182-135615204 GGAGCTCCACAGATGGGCCTAGG + Intronic
1048975022 8:139666573-139666595 GCAAGTGCAGAGCTGAGCCTAGG - Intronic
1049087921 8:140492557-140492579 GGAAGTACCCAGGTGGGCCTTGG - Intergenic
1049505134 8:142992148-142992170 GGAAAGGCACAGATGGGCCTGGG + Intergenic
1051464397 9:17360610-17360632 GGAAGTGCACAGATGGGCTTAGG + Intronic
1051775991 9:20634621-20634643 GGAAGTGCACAAATGGGCCTAGG + Intergenic
1052879958 9:33595685-33595707 GAAAATGCACAGATGCAGCTTGG + Intergenic
1052996948 9:34556109-34556131 GAAAAGGGACAGGTGGGCCTGGG - Intronic
1053496015 9:38548535-38548557 GAAAATGCACAGATGCAGCTTGG - Intronic
1053537185 9:38937619-38937641 GGAAGTGCACAGATGGGCCTTGG + Intergenic
1054628950 9:67426311-67426333 GGAAGTGCACAGATGGGCCTTGG - Intergenic
1054740307 9:68799871-68799893 AAAAGTGGACAGATAGGACTAGG + Intronic
1054885477 9:70193077-70193099 GTAAGTACAAAGATAGGCCTAGG + Intronic
1055497126 9:76866919-76866941 GAATGTGCACACAGGGGCCTGGG - Intronic
1055804271 9:80075553-80075575 GGAAGTGAACTAATGGGCCTAGG - Intergenic
1056586124 9:87928346-87928368 GAAAATGCACAGATGCAGCTTGG - Intergenic
1056610758 9:88124597-88124619 GAAAATGCACAGATGCAGCTTGG + Intergenic
1057191920 9:93093206-93093228 GGAAGTTCACAGATGGGCCAAGG - Intergenic
1057293728 9:93823485-93823507 GAATGGGCACAGAGGGGCCTGGG - Intergenic
1057299539 9:93869949-93869971 GAGAGTGAACAGAAGGCCCTAGG - Intergenic
1057598988 9:96440789-96440811 GAAAGAGCTCTGATGGTCCTAGG + Intergenic
1057630334 9:96714913-96714935 GCAAGTGCACAGATGTGCCTAGG + Intergenic
1057675944 9:97136053-97136075 GAAAATGCACAGATGCAGCTTGG - Intergenic
1059306912 9:113360907-113360929 TGAAGTGCACAGATGGGCCTGGG - Intronic
1059309609 9:113378985-113379007 GAATCTACACAGATGGGTCTTGG + Intergenic
1059660236 9:116393020-116393042 GAAACTGCCCAGACTGGCCTGGG + Intronic
1059669209 9:116477292-116477314 CAAAGTGCACAGTTGGGGCCTGG - Intronic
1060013534 9:120065880-120065902 GGAAGTACACAGATGTGCCTTGG + Intergenic
1060148956 9:121274898-121274920 GGAAGTGCACAGGTAGGCCTAGG + Intronic
1060417237 9:123440008-123440030 GAAGGTGCAAAGAAGGGCCCGGG + Intronic
1060552686 9:124492973-124492995 GGAAGTGCACAGCGGGGCCAGGG + Intronic
1061494459 9:130963756-130963778 GGAAGTGCACAGATGGGCCTAGG + Intergenic
1062506037 9:136877037-136877059 GACAGTGGACAGAGAGGCCTTGG - Intronic
1185461221 X:333559-333581 GAGGGAGCACAGCTGGGCCTGGG + Intergenic
1186244333 X:7605100-7605122 GGAGGTACACAGGTGGGCCTAGG - Intergenic
1186550248 X:10497328-10497350 GAAAGTGCGCAGAAGGGCCCAGG - Intronic
1186637516 X:11422356-11422378 GAAAGGGCACAGATGTGGCCAGG + Intronic
1187945188 X:24419449-24419471 GAAAGTGTGCAGATGGGACCTGG - Intergenic
1188539637 X:31235106-31235128 AGAAGTGCACAGGTGGGCCTAGG + Intronic
1188759031 X:34002506-34002528 TGAAATGCACAGATAGGCCTAGG + Intergenic
1189204746 X:39227999-39228021 GAAACAGCAGAGTTGGGCCTGGG - Intergenic
1190110204 X:47584427-47584449 GGAAGTGCACAGATGGGCCTAGG + Intronic
1190379748 X:49828418-49828440 GGAAATGCACAGATGGGCCTAGG + Intergenic
1190939065 X:55023659-55023681 GAAACAGTACAGAAGGGCCTTGG - Intronic
1192433925 X:71130740-71130762 GAAAGTGCACAGACATGTCTGGG - Intronic
1192475775 X:71441173-71441195 GAAAATATACAGATGGGGCTTGG - Intronic
1192510306 X:71717278-71717300 GAAAATGCAGAGCAGGGCCTGGG - Exonic
1192516391 X:71764275-71764297 GAAAATGCAGAGCAGGGCCTGGG + Exonic
1192529427 X:71872419-71872441 GAAAATGCAGAGCAGGGCCTGGG - Intergenic
1192614242 X:72601628-72601650 GGAAGTGCACAAATGGGCCTAGG + Intronic
1193218822 X:78898647-78898669 GAGCTTTCACAGATGGGCCTTGG - Intergenic
1193234011 X:79084397-79084419 AAAGGTTCACAGATGTGCCTTGG + Intergenic
1193552499 X:82914332-82914354 GGAAGTGTACAGATGAGCCTAGG - Intergenic
1194966948 X:100298966-100298988 GAAAGTTACCAGATAGGCCTTGG - Intronic
1196078152 X:111600341-111600363 GAAAGTACACATATGGGCCAAGG - Intergenic
1196220116 X:113103919-113103941 TAAAGGGCACAGATCAGCCTTGG - Intergenic
1196614685 X:117754511-117754533 GAAAGTCCACAGAGGAGCCTGGG - Intergenic
1197041425 X:121940213-121940235 GAAATTTTACAGCTGGGCCTCGG - Intergenic
1198505020 X:137292849-137292871 GAAAGTGCACAGATGAGCCAAGG + Intergenic
1201463560 Y:14255383-14255405 GGAAGTACACATGTGGGCCTTGG - Intergenic
1201579527 Y:15495977-15495999 ACAAGCACACAGATGGGCCTGGG + Intergenic
1201589648 Y:15601036-15601058 GGAAGTGCACAGATGGGCCTGGG - Intergenic