ID: 1118524238

View in Genome Browser
Species Human (GRCh38)
Location 14:66621901-66621923
Sequence CAGGCACACAGTGCTGTCGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 161}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118524231_1118524238 25 Left 1118524231 14:66621853-66621875 CCATCCCAGCTGCTTTCATTGGC 0: 2
1: 168
2: 414
3: 893
4: 1423
Right 1118524238 14:66621901-66621923 CAGGCACACAGTGCTGTCGGTGG 0: 1
1: 0
2: 0
3: 12
4: 161
1118524232_1118524238 21 Left 1118524232 14:66621857-66621879 CCCAGCTGCTTTCATTGGCTAGT 0: 1
1: 5
2: 125
3: 555
4: 1310
Right 1118524238 14:66621901-66621923 CAGGCACACAGTGCTGTCGGTGG 0: 1
1: 0
2: 0
3: 12
4: 161
1118524229_1118524238 28 Left 1118524229 14:66621850-66621872 CCTCCATCCCAGCTGCTTTCATT 0: 1
1: 10
2: 210
3: 497
4: 1248
Right 1118524238 14:66621901-66621923 CAGGCACACAGTGCTGTCGGTGG 0: 1
1: 0
2: 0
3: 12
4: 161
1118524233_1118524238 20 Left 1118524233 14:66621858-66621880 CCAGCTGCTTTCATTGGCTAGTA 0: 1
1: 1
2: 32
3: 286
4: 648
Right 1118524238 14:66621901-66621923 CAGGCACACAGTGCTGTCGGTGG 0: 1
1: 0
2: 0
3: 12
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118524238 Original CRISPR CAGGCACACAGTGCTGTCGG TGG Intronic
900544387 1:3220405-3220427 CAGGCCCACAGAGCTGTGGAAGG - Intronic
902374930 1:16026216-16026238 CAGGAACAGGGTGCTGCCGGTGG - Exonic
903805047 1:25999252-25999274 GAGGCACACACAGATGTCGGCGG - Intergenic
904368907 1:30036017-30036039 CAGGGGCACAGGGCTGTCTGGGG + Intergenic
904896408 1:33821433-33821455 CAGGCACACAGCCTGGTCGGAGG + Intronic
905223844 1:36466764-36466786 CAAGCTCACAGTGCTGGAGGAGG - Exonic
905857371 1:41322941-41322963 CCAGCACACAGAGCTGTTGGGGG - Intergenic
906541642 1:46591369-46591391 CAGGCCCCCAGTCCTGTCTGAGG - Intronic
909873340 1:80772921-80772943 CAGGCACACAGTGCTGCTCCAGG - Intergenic
912725266 1:112053664-112053686 CTGTCACACAGTGCTATGGGGGG + Intergenic
913959312 1:143326989-143327011 AAGGCACACAGCGCTGGCGCCGG + Intergenic
914053631 1:144152369-144152391 AAGGCACACAGCGCTGGCGCCGG + Intergenic
914125566 1:144814172-144814194 AAGGCACACAGCGCTGGCGCCGG - Intergenic
920812403 1:209299055-209299077 CAGGCACACAAAGCTGAGGGAGG - Intergenic
922617729 1:226973046-226973068 AGGGCACACAGTGCTGTTGCAGG - Intronic
1062892530 10:1074900-1074922 CGTGCACACAGTGCTGGCTGCGG + Intronic
1067204013 10:44198365-44198387 CAGGCACTCAGTGCAATCTGAGG - Intergenic
1069992248 10:72322909-72322931 CAGGCCCACAGTGCAGTCCGAGG - Intergenic
1070775564 10:79107884-79107906 CAGGCACAGAGTCCTGCCTGAGG + Intronic
1071986605 10:91057846-91057868 CAGGCACACACTGGTGACTGAGG + Intergenic
1073585801 10:104708783-104708805 AAGGCACCCAGTGCAGTCTGAGG - Intronic
1073815681 10:107204174-107204196 AACGCACACAGGCCTGTCGGAGG + Intergenic
1074999045 10:118781963-118781985 CAGGCATACAGTGGTGGCTGGGG - Intergenic
1076401334 10:130187266-130187288 CAGGCAAAAAGTGCTGTTGGAGG + Intergenic
1077113597 11:872927-872949 GAGGCACCCAGTGCTCTCAGGGG - Intronic
1078265854 11:9755993-9756015 CAAGCAGAAAGTGTTGTCGGAGG - Intergenic
1079655035 11:22976215-22976237 CAGGCACACAGTGCAAGCTGTGG - Intergenic
1083318823 11:61832822-61832844 AGGGCACACAGTGCAGTAGGTGG - Intronic
1083851635 11:65371078-65371100 CAGGCCCACACTGCTGTCTCTGG - Intergenic
1084729399 11:71063895-71063917 CAGGCACACTGTGTTCTCAGCGG - Intronic
1087129767 11:94658530-94658552 CAGGCACACAGTCTTCTCTGGGG - Intergenic
1091277867 11:134364527-134364549 CAGGCACACAGTGGCATGGGCGG - Intronic
1091590574 12:1840623-1840645 CAGGGCCACAGTCCTGCCGGTGG - Intronic
1091804711 12:3347639-3347661 CAGGGTCACACTGCTGTAGGTGG - Intergenic
1091874279 12:3920636-3920658 CAGCCACACTGCGATGTCGGAGG - Intergenic
1095444185 12:42267994-42268016 CAGGCATCCCGTGCTCTCGGGGG - Intronic
1097335958 12:58383538-58383560 CAGGCAGACAGTGCTGCTTGAGG + Intergenic
1100705684 12:97197818-97197840 CAGGCACAAAGTTCTGGAGGTGG + Intergenic
1103441854 12:120968898-120968920 AAGGCTCACATTGCTGTGGGTGG + Intergenic
1104943667 12:132406240-132406262 CAGGCCCACAGGGCTGGCAGTGG - Intergenic
1106593069 13:31114525-31114547 CAGGCACACAGTGCAGTCAAGGG - Intergenic
1111932285 13:94524505-94524527 CAGGCTCAGAGTCCTGTCTGAGG + Intergenic
1115146232 14:30229157-30229179 GAGGCACAGAGTGCTGTCCGTGG - Intergenic
1115742890 14:36406607-36406629 TAGACACACAGTGCTGTGAGAGG - Intergenic
1118524238 14:66621901-66621923 CAGGCACACAGTGCTGTCGGTGG + Intronic
1122342270 14:101036097-101036119 GAGGCACTCAGTGCTTTAGGAGG - Intergenic
1122606696 14:102951379-102951401 AAGCCACCCAGTGCTGTGGGAGG - Intronic
1128522524 15:68385311-68385333 CAGGCATAGAGTGCTGTCTCGGG - Intronic
1129073077 15:72968016-72968038 CAGGCAAACAGAGCTGCCTGGGG + Intergenic
1129691221 15:77714666-77714688 CAGGCACTCAGTAATGTCTGTGG + Intronic
1132810411 16:1794225-1794247 CAGGCCCACGGTGCTGTCCAGGG + Intronic
1134664561 16:16009523-16009545 CAGACAAACAGTCCTGTTGGAGG + Intronic
1136503652 16:30688451-30688473 GGTGCACACACTGCTGTCGGAGG - Intergenic
1139776813 16:69321528-69321550 AGAGCACACAGTGCTGACGGAGG - Intronic
1140191758 16:72823477-72823499 CAGACACACTGTGTTGTCAGAGG - Intronic
1141662098 16:85446914-85446936 CAGGCACACAGAGCAGGAGGAGG - Intergenic
1142099761 16:88264944-88264966 CGGGCACACAGGGCTGACTGCGG + Intergenic
1145828756 17:27897945-27897967 AGGTCACACAGTGCTCTCGGGGG + Intergenic
1148104203 17:45110732-45110754 CTGGCACTCAGGGCTGTCAGAGG - Exonic
1148141720 17:45333795-45333817 CAGGCTCACAGTGCTTTCCAAGG - Intergenic
1151199109 17:72454699-72454721 CAGGCACACAGTGGTGCCACAGG + Intergenic
1151353608 17:73545815-73545837 CAGGCACACTGTGAGGTTGGTGG - Intronic
1152278548 17:79372181-79372203 CGGGCAGGCAGTGCTGTCCGGGG - Intronic
1153587709 18:6640521-6640543 CATGCACACAGTCCTTTGGGTGG + Intergenic
1153646171 18:7198016-7198038 CATGCATGCAGTGCTGACGGTGG + Intergenic
1153739215 18:8105677-8105699 CAGGCCCCCAGTGCTGAGGGCGG + Intronic
1155722048 18:29027714-29027736 CTGGGACACAGTGCCGTGGGGGG - Intergenic
1156492212 18:37502887-37502909 CAGGCACCCAGTGCTGGGGTCGG + Intronic
1157176166 18:45454299-45454321 CAGGTTCACAGAGCTGTCTGGGG + Intronic
1158570859 18:58596072-58596094 CAGCCACACAGTGCATGCGGGGG - Intronic
1159506836 18:69349123-69349145 CAGGCACACAGTGATTTTAGGGG + Intergenic
1161167652 19:2796865-2796887 CAGGCACACCGGGCAGTGGGTGG - Intronic
1161354078 19:3809490-3809512 CACCCACACAGTGCTGTGGGAGG - Intronic
1161800493 19:6414806-6414828 CAGGCAGACAGCGCGGACGGTGG - Intronic
1163394943 19:17054397-17054419 CAGGAACCCAGTGCTTTGGGAGG + Intronic
1163513679 19:17750305-17750327 CAGGCTCACAGTGCTTTTAGGGG + Intronic
1202693028 1_KI270712v1_random:104792-104814 AAGGCACACAGCGCTGGCGCCGG + Intergenic
927990638 2:27444498-27444520 CTGGCACACTGGGCTGTGGGAGG + Exonic
933953369 2:87349170-87349192 AAGGCACACAGCGCTGGCGCCGG - Intergenic
934237578 2:90245419-90245441 AAGGCACACAGCGCTGGCGCCGG - Intergenic
934275625 2:91571311-91571333 AAGGCACACAGCGCTGGCGCCGG + Intergenic
934721495 2:96580282-96580304 CATGCACACATTTCTGTTGGAGG - Intergenic
934946633 2:98547210-98547232 CAGGTGCACAGTGCTGGGGGCGG + Intronic
942422564 2:175822970-175822992 CAGGCACACAGAGGGGTGGGAGG + Intergenic
943247508 2:185473956-185473978 CAGCCACCCAATGCTGACGGAGG - Intergenic
943698981 2:190969278-190969300 TATGCACACAGTGCTTTCCGTGG - Exonic
943787414 2:191893471-191893493 CAGGAAAACAGGGCTGTCTGGGG + Intergenic
1172620884 20:36317859-36317881 CAGCCACACAGGGCTGGCTGAGG + Intronic
1173249229 20:41355931-41355953 CAGGATCACAGGGCTGTCTGGGG - Exonic
1174219499 20:48942072-48942094 CTGGCACTCAGTGCTGTCAGAGG + Intronic
1175166251 20:57046880-57046902 CAGGCACAGGGTGCAGGCGGGGG + Intergenic
1175530685 20:59672696-59672718 CGGGCACACAGTGGTGTCTCAGG - Intronic
1175895055 20:62332468-62332490 CCGGCACAGGGTGCTGTGGGGGG + Exonic
1176704360 21:10100995-10101017 CAGGCACATGGTGTTGTTGGTGG + Intergenic
1177129363 21:17237662-17237684 CAGGCACACAGTCTTATCGAGGG - Intergenic
1179640930 21:42746772-42746794 CAGGCACGCCGGGCTGTGGGGGG + Intronic
1180384029 22:12167163-12167185 GAGGCCCACAGTGCTGGCGCAGG + Intergenic
1180820140 22:18821489-18821511 CAGACACAAAGGACTGTCGGAGG - Intergenic
1181065686 22:20304826-20304848 CAGGTCCACAGTGCTGAGGGAGG - Intergenic
1181166922 22:20988902-20988924 CCGGGTCTCAGTGCTGTCGGAGG - Intronic
1181174025 22:21025938-21025960 CAGGCAGACAGGGCTGGAGGAGG + Intronic
1181206363 22:21255961-21255983 CAGACACAAAGGACTGTCGGAGG - Intergenic
1181528727 22:23504001-23504023 CACACACACAGTGCAGTCAGAGG + Intergenic
1183347950 22:37318318-37318340 CTGGCACACAGAGCTGCCAGGGG + Intergenic
1184954611 22:47877413-47877435 CAGGCACACAGCACTGTGGTTGG - Intergenic
1185250201 22:49797440-49797462 CAGCCACACAGTCCTCTTGGTGG + Intronic
1203220557 22_KI270731v1_random:39462-39484 CAGACACAAAGGACTGTCGGAGG + Intergenic
1203270267 22_KI270734v1_random:47360-47382 CAGACACAAAGGACTGTCGGAGG - Intergenic
950949765 3:16986082-16986104 CAGGCACAAGGAGCTGTAGGGGG + Intronic
953439677 3:42906654-42906676 AGCGCACAGAGTGCTGTCGGGGG + Intronic
954493552 3:50930805-50930827 CAGGAACCCAGTGCTGTCTGTGG + Intronic
956166700 3:66402808-66402830 GAGCAACACAGTGCTGTCTGTGG + Intronic
957005353 3:74939247-74939269 CAAGCACATAGTGCTGTTGATGG - Intergenic
957732078 3:84151617-84151639 CAGGCTCACAGTCCTGGCTGTGG - Intergenic
958642287 3:96820424-96820446 CTGGCATAGAGTGATGTCGGTGG + Intronic
959094731 3:101941868-101941890 CAGACACACAAAGCTGTTGGAGG - Intergenic
961796593 3:129413363-129413385 CAGGCACAGAGGGAGGTCGGGGG + Intronic
962201124 3:133401905-133401927 CATGCACTCTGTGCTGTCAGTGG - Intronic
962385620 3:134930050-134930072 GAGGCACACAGTGCTGCCAGGGG + Intronic
962394128 3:134999972-134999994 CAGGCACACAATGCACTCTGTGG + Intronic
963586331 3:147194215-147194237 CATCAACACAGTGCTGTTGGTGG + Intergenic
963952253 3:151215816-151215838 CAGGAACTCAGTGCTGGGGGTGG - Intronic
965576963 3:170227309-170227331 CAGGCACATGATGCTGTCGTAGG + Intronic
969652959 4:8478488-8478510 CAGGGGCACAGTGCTGCTGGGGG - Intronic
969854040 4:9984870-9984892 CAGGCACACAGTCCTCGCCGTGG + Intronic
972270080 4:37502502-37502524 CAGGCACAGGGTGCTGGTGGGGG + Intronic
979946916 4:126843736-126843758 CAGGCAGACTGTGCTGTGGCAGG - Intergenic
980376572 4:131957329-131957351 CAGGCACATGGTGCTGTTGGTGG + Intergenic
980745120 4:137002126-137002148 CAGGCACAGAGGGCTGTGTGAGG - Intergenic
983226728 4:165092416-165092438 CCGGCCCACAGTGCTGTCCTAGG + Intronic
987436321 5:17898015-17898037 CAGGCAAACAGTCCTGCTGGAGG + Intergenic
989753454 5:44922913-44922935 CAGGCACACAGTGCAAGCTGTGG - Intergenic
991957908 5:72014214-72014236 CAGGCACACACTTCTGTGAGAGG + Intergenic
1001852809 5:174984338-174984360 CAGGCACACACTTCTGCAGGAGG + Intergenic
1001950540 5:175813640-175813662 CAGGCACACAGAGCAGTCCGAGG + Intronic
1002280556 5:178127555-178127577 CAGGCACACAGTCCTGCTGTGGG + Intergenic
1003561534 6:7184717-7184739 CAGGCACACTGTGCGGCTGGTGG - Intronic
1005984087 6:30859751-30859773 CAGGCACACAGTGCAAGCTGTGG + Intergenic
1010248303 6:73682541-73682563 CAGGCACACAGTGCAAGCTGTGG + Intergenic
1012386214 6:98686171-98686193 GAGGCACACAGTGCTGTTCAGGG - Intergenic
1016401827 6:143689204-143689226 AAGGCACAGAGAGCTGTGGGTGG - Intronic
1018068025 6:160137255-160137277 CAGGCCCAGAGTGCAGTTGGGGG - Intronic
1018845179 6:167551122-167551144 CAGGCACACAGTGGTGGAGATGG - Intergenic
1020100181 7:5390009-5390031 AAGGCACCCAGGGCTGTGGGTGG + Intronic
1022887685 7:34663250-34663272 CAGGCCCACATTGCTTTCTGGGG + Intronic
1024266626 7:47611649-47611671 GGAGCAGACAGTGCTGTCGGCGG - Intergenic
1030097761 7:105916103-105916125 CAAGCCCACAGTGCAGTTGGAGG - Intronic
1031924872 7:127629664-127629686 CAGGCACACAGTGCAGGGTGGGG - Intergenic
1043591798 8:81841950-81841972 CAGACGCACAGTGGGGTCGGCGG + Intronic
1046359491 8:113131745-113131767 CAGGTGCACGGTGCTGTTGGTGG - Intronic
1049470375 8:142772635-142772657 CAGGGCCACAGTGCAGTGGGGGG + Intronic
1050433230 9:5583511-5583533 CAAGTACACAGTGCTGACTGGGG - Intergenic
1053641621 9:40088011-40088033 CAGGCACATGGTGTTGTTGGTGG + Intergenic
1053764514 9:41377453-41377475 CAGGCACATGGTGTTGTTGGTGG - Intergenic
1054322509 9:63685400-63685422 CAGGCACATGGTGTTGTTGGTGG + Intergenic
1054543130 9:66288630-66288652 CAGGCACATGGTGTTGTTGGTGG - Intergenic
1056846762 9:90045026-90045048 CAGGCACACAGGGCAGAGGGAGG - Intergenic
1058810991 9:108639332-108639354 CAGCCACACAGTGATGTGGCTGG - Intergenic
1060937932 9:127526798-127526820 CAGCCACAGAGAGCTGTTGGAGG - Intronic
1061211447 9:129195744-129195766 GAAGCACACGGTGCTGTGGGAGG + Intergenic
1061255387 9:129452153-129452175 CACACACACAGTGCAGTCAGAGG - Intergenic
1061823147 9:133239652-133239674 CAGGCACACAGAGCAAGCGGCGG + Intergenic
1062553469 9:137101587-137101609 CTCGGCCACAGTGCTGTCGGAGG - Exonic
1062565101 9:137160833-137160855 CAGGCAGACGATGCTGACGGTGG + Intronic
1202789397 9_KI270719v1_random:71097-71119 CAGGCACATGGTGTTGTTGGTGG + Intergenic
1203791141 EBV:152219-152241 CAGGCACACATTTCTGTGGGAGG + Intergenic
1186158609 X:6752180-6752202 CAGGAAGAAAGTGCTGTCAGAGG - Intergenic
1194368713 X:93043144-93043166 CAGGCACACACAGCTATGGGTGG + Intergenic
1196393497 X:115234062-115234084 CAGGCTGACAGTATTGTCGGGGG - Exonic
1196502922 X:116406542-116406564 CAGGCACAAAATGCTATGGGAGG - Intergenic
1200676916 Y:6159473-6159495 CAGGCACACACAGCTATGGGTGG + Intergenic
1201552201 Y:15229385-15229407 CAGGAAGAAAGTGCTGTCGGAGG - Intergenic
1202371731 Y:24202909-24202931 GAGGCACACATTGGTCTCGGTGG - Intergenic
1202499054 Y:25467207-25467229 GAGGCACACATTGGTCTCGGTGG + Intergenic