ID: 1118525428

View in Genome Browser
Species Human (GRCh38)
Location 14:66635228-66635250
Sequence ATGTGGCAGTGTAACATCTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 103}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118525428_1118525435 27 Left 1118525428 14:66635228-66635250 CCTTAGATGTTACACTGCCACAT 0: 1
1: 0
2: 0
3: 9
4: 103
Right 1118525435 14:66635278-66635300 CAATTCAGATTTAACAGATAGGG 0: 1
1: 0
2: 3
3: 21
4: 375
1118525428_1118525436 28 Left 1118525428 14:66635228-66635250 CCTTAGATGTTACACTGCCACAT 0: 1
1: 0
2: 0
3: 9
4: 103
Right 1118525436 14:66635279-66635301 AATTCAGATTTAACAGATAGGGG 0: 1
1: 0
2: 0
3: 23
4: 255
1118525428_1118525431 -5 Left 1118525428 14:66635228-66635250 CCTTAGATGTTACACTGCCACAT 0: 1
1: 0
2: 0
3: 9
4: 103
Right 1118525431 14:66635246-66635268 CACATTCCATTGGTCAAAAGAGG 0: 1
1: 1
2: 5
3: 33
4: 213
1118525428_1118525434 26 Left 1118525428 14:66635228-66635250 CCTTAGATGTTACACTGCCACAT 0: 1
1: 0
2: 0
3: 9
4: 103
Right 1118525434 14:66635277-66635299 CCAATTCAGATTTAACAGATAGG 0: 1
1: 0
2: 0
3: 14
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118525428 Original CRISPR ATGTGGCAGTGTAACATCTA AGG (reversed) Intronic
901609612 1:10487262-10487284 ATGTGGATGTGTAAAATCTTTGG + Intronic
908017552 1:59859582-59859604 ATTTGGCAGGGGAACAACTAAGG + Intronic
909486264 1:76177932-76177954 ATCTAGCAGTGTAACAGTTAGGG + Intronic
911696918 1:100899498-100899520 ATGTGGTTTTGTATCATCTACGG + Intronic
913015839 1:114733613-114733635 ATGTGGTAGTGGAACAACTAAGG - Intronic
915534093 1:156524150-156524172 ATATGCCAGTGTAACCTCTTTGG - Intergenic
916668586 1:166990102-166990124 TAATGGGAGTGTAACATCTAGGG + Intronic
916737469 1:167620671-167620693 ATGTTGCAGTTTTACCTCTAAGG - Intergenic
920581434 1:207111714-207111736 ATGTGGGACTGAAACATCTTGGG + Intronic
920951047 1:210572064-210572086 CCGTGCCAGTGTAACATTTACGG - Intronic
924750721 1:246886523-246886545 TTGTTATAGTGTAACATCTAGGG + Intronic
1063108693 10:3016404-3016426 ATGTGGGTGTGGAACATGTATGG - Intergenic
1069189976 10:65475106-65475128 ATGTGACATTTTAACATCAATGG - Intergenic
1072719384 10:97771373-97771395 TTGTGGCAGTGCAGCATCTCAGG + Exonic
1073852242 10:107634490-107634512 ATGTGACAAAGTAACATCAAGGG + Intergenic
1074749581 10:116571937-116571959 ATGATGCTATGTAACATCTAAGG - Intergenic
1075527734 10:123200397-123200419 ATGTTGGAGTGTGACATCTCAGG - Intergenic
1077387357 11:2276514-2276536 ATCTGACAGTGTGACATCTTGGG + Intergenic
1077851833 11:6080382-6080404 AAGTGGCAGTGTTACAGCTTTGG - Intergenic
1078870031 11:15334905-15334927 ATGTGGGAGTGTAATTGCTAAGG + Intergenic
1079509864 11:21198298-21198320 ATGTGGCTGTGTTACTTCTAAGG - Intronic
1081714665 11:45240990-45241012 ATTTGGCAGTTTGACATCTCTGG + Exonic
1082864482 11:57886224-57886246 ATGTGGCAGTTTAGCCTCTATGG + Intergenic
1088566139 11:111175103-111175125 AAGTGGCAGTGTTACAGCTCCGG + Intergenic
1090480490 11:127063433-127063455 ATGTAAAAGTGTATCATCTATGG - Intergenic
1093158062 12:15712310-15712332 ATTTGGCAGTGTTAAATCTGTGG + Intronic
1093846795 12:23981919-23981941 ATGTGTCATTGTAATATTTATGG + Intergenic
1096901915 12:54892089-54892111 ATGTAGCAGTGTAAAATGGAAGG + Intergenic
1104099992 12:125598709-125598731 ATGTGGCAATGGATCATGTAAGG - Intronic
1109647680 13:65280795-65280817 TTGTGGCATTTTAACATTTAAGG + Intergenic
1113259544 13:108546429-108546451 ATGTGGCAATGCAATATCTCTGG + Intergenic
1113655256 13:112063861-112063883 ATGTGTGCGTGTAACTTCTAGGG + Intergenic
1118525428 14:66635228-66635250 ATGTGGCAGTGTAACATCTAAGG - Intronic
1123911858 15:24976063-24976085 TTGTTGTAGTGTAACATCAAAGG + Intronic
1125799901 15:42436363-42436385 ATGTATAAGTGTAAGATCTAGGG - Intronic
1129684671 15:77678249-77678271 GTGTGGCTGTGTAACCACTATGG + Intronic
1131790936 15:95964962-95964984 AGGTGGCAGTGTCACAGCTCTGG - Intergenic
1137433543 16:48437285-48437307 CAGTGGCTGTGTATCATCTATGG - Intronic
1139693694 16:68657573-68657595 CTGTGGCTGTCTAACATCTGAGG + Intronic
1146420911 17:32684562-32684584 CTGTGGAAGTGTTACATCCAAGG + Intronic
1153908287 18:9683548-9683570 ATGTGGCCGGATAACATTTATGG + Intergenic
1156666489 18:39414289-39414311 ATGTTGCAGAATACCATCTAAGG - Intergenic
1158543305 18:58375568-58375590 ATGTGGCACTGAAGCATCTCTGG - Intronic
1158941511 18:62409454-62409476 ACCTGGGAGTGTAACTTCTATGG + Intergenic
1159612340 18:70539857-70539879 ATGTGGCAATGAAATATCTCAGG - Intergenic
1163469679 19:17489022-17489044 GTGGGGCAGTGTCTCATCTATGG + Exonic
1166093220 19:40523578-40523600 CTGAGGCAGGGCAACATCTACGG + Exonic
925938383 2:8790176-8790198 AAGTGGCAGTATTCCATCTAGGG - Intronic
926048083 2:9724761-9724783 ATGTGGGAGTGGAACAGCTGGGG - Intergenic
926635815 2:15178144-15178166 ATGTGGCAGGATATCTTCTAGGG - Intronic
929334204 2:40720832-40720854 ATATGTAAGTGTAACATCTGGGG + Intergenic
930440621 2:51400070-51400092 AAATGGAAGTGTAACATCTATGG - Intergenic
931128866 2:59309313-59309335 ATGAGGCAGTAAAACCTCTAAGG + Intergenic
931765535 2:65452798-65452820 AAAAGGCAGTGTAACATCTTGGG + Intergenic
938617715 2:133016853-133016875 ATGTGGCAATGCAATATTTATGG + Intronic
948657308 2:239484593-239484615 AGGTGGCAGAATGACATCTATGG + Intergenic
1170041333 20:12042953-12042975 TTGTGGCAGTGGAGTATCTATGG - Intergenic
1170065479 20:12305529-12305551 TTGTGGCAATGTAGCATCAAGGG - Intergenic
1172570754 20:35968495-35968517 ATGTGGGAGTCTAACATTTATGG - Intronic
1173583215 20:44161933-44161955 AGGTGGCTGTGTACCATCTGAGG - Intronic
1177018316 21:15818493-15818515 ATGTGGATGTGTAATATCTATGG + Intronic
1182915119 22:34022232-34022254 ATGTGAAAGTGTAAATTCTAGGG + Intergenic
1182957262 22:34438266-34438288 TTGTGTCAGTGTAAAATCTTAGG - Intergenic
950873660 3:16250843-16250865 ATGTGGTAGTGTGACTACTAAGG + Intergenic
952511637 3:34063995-34064017 CTGAGGCAGTGGATCATCTAAGG - Intergenic
952853131 3:37745176-37745198 ATGTGGCAGTAAAACATTTGTGG + Intronic
955086222 3:55705555-55705577 ATGTCACACTGTAACATCTCTGG + Intronic
955781222 3:62486740-62486762 AAGTGGTAGTGTAAAATCTCTGG + Intronic
960348787 3:116568245-116568267 ATGTGACAGTGTAAAATCACTGG - Intronic
962471682 3:135714697-135714719 ATGTGGCAGTGAACCACCCAGGG + Intergenic
963917590 3:150873312-150873334 ATTTGGCTGTGCAACATCAATGG - Exonic
965544269 3:169899316-169899338 ATGTGGCAATGTAGAATGTAAGG - Intergenic
966774399 3:183531281-183531303 AGGTGGCAGTGTCACCTCCATGG - Intronic
971160819 4:24132181-24132203 TTGCAACAGTGTAACATCTAAGG - Intergenic
971485908 4:27159993-27160015 CTGTGACAGGGTAACATTTAAGG - Intergenic
980525097 4:133979729-133979751 ATGTGACTGTCTAAAATCTATGG + Intergenic
989169815 5:38462975-38462997 ATGCGGCAGCTTAACATCAATGG + Exonic
990971410 5:61510554-61510576 AGATGGCACTGTAACATATAAGG - Intronic
992069644 5:73136883-73136905 TGGAGGCAGTGTAACACCTATGG - Intergenic
994268424 5:97745719-97745741 CTGAGGCAGTGGACCATCTAAGG - Intergenic
995200387 5:109418805-109418827 ATCTGGCAGTCTAACAGCTAAGG - Intergenic
995205816 5:109480205-109480227 AAGTGACAGTGTAATATCTCTGG + Intergenic
995700921 5:114934213-114934235 ATGTGTCAGGGAAACATGTAAGG + Intergenic
996009843 5:118469666-118469688 ATCTGGCAGAGTTACATCTGCGG - Intergenic
996256337 5:121408850-121408872 ATGTGACAGTGTACAATCTCAGG + Intergenic
1009350149 6:62664949-62664971 ATTTTGCAGTGTATCATTTATGG - Intergenic
1011009011 6:82682643-82682665 ATGTGGGAGTGTCACATGGAGGG - Intergenic
1015756824 6:136615842-136615864 ATTTGTCAGTGTAAGATCTAAGG - Intronic
1017110307 6:150925866-150925888 AGGTGGAAGTATAACACCTATGG - Intronic
1018094124 6:160370159-160370181 ATGAGGCAGTGTGACTTCTGAGG - Intronic
1022403718 7:30066406-30066428 AAGGGGCAGTGTAAAGTCTAAGG - Intronic
1024287592 7:47772773-47772795 ATGTGCCAGTGCATCTTCTAAGG - Intronic
1025068378 7:55877150-55877172 ATGTGGCAGTGGCATATCAAAGG + Intergenic
1031500890 7:122514556-122514578 TAGTGGGAGTGTAACATCTTGGG + Intronic
1037247886 8:16857644-16857666 AAGTTGCAATGTAACATCCATGG - Intergenic
1043005269 8:74810617-74810639 ATGTGGCCCTGTGACAGCTATGG - Intronic
1045112176 8:98946661-98946683 TTGTGGCAGTGTAACCTTTATGG + Intronic
1046924079 8:119767919-119767941 AGGTGGCAGTGTGGCATCTGTGG - Intronic
1051595189 9:18818143-18818165 TTGTGGCAGTGAAACCCCTAGGG - Intronic
1051641401 9:19228180-19228202 AAATGGCAGTGAAAAATCTATGG + Intergenic
1054701749 9:68419754-68419776 AATTTTCAGTGTAACATCTAGGG + Intronic
1056721736 9:89077958-89077980 ATGTGCAAGTGTAGCATCTCTGG - Intronic
1060258861 9:122056244-122056266 TTGTGGCAGTGGCACATCTCTGG - Intronic
1060441982 9:123648870-123648892 AGGTGGCATTGTAGCATCTCTGG - Intronic
1187433897 X:19249393-19249415 ATGTGGCAGAGGAACATCATGGG - Intergenic
1189408022 X:40743440-40743462 ATGCTGCAGTGCTACATCTAGGG + Intergenic
1189912776 X:45828023-45828045 ATGTGACACTGTAACACTTAGGG - Intergenic
1193235459 X:79101118-79101140 ATGCAGCAGTGTTACATCTCTGG - Intergenic
1197100093 X:122642733-122642755 CTGAGGCACTGTAACATTTAGGG - Intergenic
1197605751 X:128583136-128583158 CTGTGCCATTGTAACATGTATGG - Intergenic
1198686536 X:139233597-139233619 ATGTGGCTGAGAAACTTCTAAGG - Intergenic
1199540518 X:148953229-148953251 ATGGGACAGTTCAACATCTAAGG + Intronic
1201350276 Y:13032573-13032595 ATGTGGCAATAAAACATATAGGG + Intergenic