ID: 1118525851

View in Genome Browser
Species Human (GRCh38)
Location 14:66641620-66641642
Sequence TTCTATCAGCTATTGATGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 162}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118525851_1118525853 10 Left 1118525851 14:66641620-66641642 CCAACCATCAATAGCTGATAGAA 0: 1
1: 0
2: 1
3: 21
4: 162
Right 1118525853 14:66641653-66641675 ACAAAAAAAAAAAAAGAGAGAGG 0: 2
1: 144
2: 2170
3: 18882
4: 79470

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118525851 Original CRISPR TTCTATCAGCTATTGATGGT TGG (reversed) Intronic
909486156 1:76176565-76176587 ATCTATAAGCTAATGCTGGTGGG - Intronic
910894585 1:92054612-92054634 TTCTGACTGCTATTAATGGTAGG - Intronic
914896466 1:151679124-151679146 TTGTATCATATTTTGATGGTAGG + Intronic
915780169 1:158540576-158540598 TTCTATCAGTTATTGAAGTGGGG + Intergenic
916267881 1:162909572-162909594 TTCTATCCGTTATTGAAAGTGGG + Intergenic
916392982 1:164352749-164352771 ATTTATCTGATATTGATGGTGGG - Intergenic
921978213 1:221226318-221226340 TTCTATCAAATATTGATTGCAGG + Intergenic
922524713 1:226291711-226291733 TACTATAAGATATTGATGTTAGG - Intronic
924412641 1:243821846-243821868 ATCTATCTAATATTGATGGTGGG - Intronic
924549273 1:245059609-245059631 TTCTTTCAGATTTTGTTGGTTGG - Intronic
1063306415 10:4906027-4906049 CTCAATCATCTATTGATGGTGGG + Intergenic
1063849655 10:10172317-10172339 TTCTATCAAATATTGAGAGTGGG + Intergenic
1064497252 10:15924990-15925012 TTCTATTAATTATTGAGGGTAGG + Intergenic
1067688774 10:48486796-48486818 TTCTTTCAGCTATTGAGTGTGGG + Intronic
1067736534 10:48857351-48857373 TCCTATAAGCTCTTGGTGGTGGG + Intronic
1067959549 10:50832997-50833019 ATCTATCAGCTAATGATACTGGG - Intronic
1070483475 10:76908262-76908284 TTCTACCTGCTAGTGATGTTGGG - Intronic
1071612312 10:87042721-87042743 TTCTATTTACTATTGAAGGTGGG + Intergenic
1074356371 10:112788219-112788241 TTCTATCAGTTATTGAGAATAGG + Intronic
1074825556 10:117213342-117213364 TTCTATCAGTCATTGATTGAGGG - Intergenic
1078038957 11:7839439-7839461 TTCTATTAGATCATGATGGTAGG + Intergenic
1078522588 11:12075356-12075378 TTATTTCAGTTATTGATTGTGGG - Intergenic
1083536700 11:63475218-63475240 TTCTATCCACTATTGAGAGTGGG + Intronic
1086117435 11:83267471-83267493 TTGTATCAGCTGTTGAAGCTTGG - Intronic
1087930537 11:103972683-103972705 TTCTCTGAGCTAATGATGGGAGG + Intronic
1087980459 11:104606825-104606847 TTCTATCAATTATTGAGAGTGGG + Intergenic
1090414052 11:126528614-126528636 TTTAATCAGCTATGTATGGTAGG + Intronic
1095870682 12:47024259-47024281 TTATATAAGCTATTGTTTGTAGG + Intergenic
1096436724 12:51597248-51597270 TTATATTCACTATTGATGGTAGG + Intronic
1097523448 12:60699166-60699188 TTCTATAAGCTATTGGGGGATGG + Intergenic
1097582601 12:61476147-61476169 TTCTAACAACTATTGATGGCTGG - Intergenic
1097679900 12:62638877-62638899 TTCTATCAATTATTGAAAGTAGG - Intergenic
1101540740 12:105662802-105662824 TTTTATCAGCGATTGATGTAGGG + Intergenic
1101889288 12:108698003-108698025 TTCTACCAGCTACTGATGCCTGG + Intronic
1101960248 12:109243720-109243742 TTCTTTCAGGCATTGATGGTGGG - Intronic
1102513355 12:113430363-113430385 TTTAATCAGCTATTGTTGCTTGG + Intronic
1105416209 13:20214059-20214081 TTCTATCAGTTATTGAGAGAGGG - Intergenic
1106619622 13:31360857-31360879 TTCTTTAAGCCACTGATGGTTGG - Intergenic
1106932447 13:34681530-34681552 GTCTATCAGCTGTTGCTGTTTGG - Intergenic
1109083726 13:57942464-57942486 TTCTATCAACAATTGATAGCTGG + Intergenic
1109108077 13:58279969-58279991 TTTGATCAGCTATTGAGGGTGGG + Intergenic
1109486840 13:63034930-63034952 TTTTATAAGCTTTTGATGTTCGG - Intergenic
1109499943 13:63221386-63221408 CTCTATCGACTATTGAAGGTAGG - Intergenic
1110589773 13:77242759-77242781 TTCTAATAGTTATTGATAGTAGG + Intronic
1111657340 13:91170405-91170427 TTCTTTAAGTGATTGATGGTTGG - Intergenic
1114368882 14:22063081-22063103 TTCTATTAGTTATTGAGAGTGGG + Intergenic
1114374170 14:22125628-22125650 TTCTTTCACCTACTGTTGGTTGG - Intergenic
1115883811 14:37949152-37949174 CTTTATCTGCTTTTGATGGTGGG + Intronic
1115897690 14:38107559-38107581 TTCTATCTGCTAGTGTTGGCAGG - Intergenic
1116272716 14:42792714-42792736 TTCAATCAACTATTAATGATGGG + Intergenic
1117309958 14:54511250-54511272 TTCTATGCTCTATTGCTGGTAGG - Intronic
1118525851 14:66641620-66641642 TTCTATCAGCTATTGATGGTTGG - Intronic
1120237290 14:81906583-81906605 ATCTATCAGCTGTTGTTTGTGGG + Intergenic
1120720299 14:87883009-87883031 TTCTATGAGGTCATGATGGTGGG + Intronic
1122527946 14:102401999-102402021 TTCTATCCATTATTGATAGTGGG - Intronic
1124228975 15:27925155-27925177 TTCTATCAGTTATTGAGAGTGGG - Intronic
1125120257 15:36148710-36148732 TTCTATCTGTTATTGATTGTAGG - Intergenic
1128854495 15:70997115-70997137 TTCTATCCATTATTGAAGGTAGG + Intronic
1129128605 15:73469175-73469197 TTCTATCAGTTATTGAGAGAGGG + Intronic
1131434732 15:92413818-92413840 TTCTATAAGAAATTGATGGCAGG + Intronic
1132068764 15:98756145-98756167 TTCTATCAGGTATTGATATTAGG + Intronic
1136603964 16:31319259-31319281 TTCTATTTGCTATTGAAAGTAGG + Intronic
1137320749 16:47379344-47379366 TGGTATCAACTATTGTTGGTTGG - Intronic
1138658066 16:58501974-58501996 TTCTCTCAGCTCTGGAGGGTGGG - Intronic
1138753987 16:59459791-59459813 TTGTATCAGCTATTGATGGAGGG + Intergenic
1139517953 16:67462900-67462922 TCCTGTCAGCTCTTGATGCTGGG + Intronic
1145355975 17:22152236-22152258 TTTTATAAGCTTTTGATGTTGGG + Intergenic
1146753301 17:35402067-35402089 TTCTAGCAGGTATTGATAGAAGG + Intergenic
1148853454 17:50565878-50565900 TTTTCTCTGCTTTTGATGGTGGG + Intronic
1149182880 17:53961337-53961359 CTCTCTCAGCTGTTGTTGGTGGG + Intergenic
1152205375 17:78971862-78971884 TTCCAGCAGCTCTGGATGGTGGG + Exonic
1154032006 18:10761700-10761722 TCATAACAGCTATTTATGGTGGG + Intronic
1156640823 18:39095679-39095701 TTCTATCAGTTACTGACAGTTGG + Intergenic
1157782766 18:50454758-50454780 TTCTGCCAGCTGCTGATGGTAGG + Intergenic
1158837035 18:61341616-61341638 TTCAATGAGGTAATGATGGTTGG - Intronic
1165670117 19:37670927-37670949 TTCTATCAGTTATTGAGAGATGG - Intronic
1166655483 19:44608179-44608201 TTCTACCAGCTAGGGATGTTAGG + Intergenic
1168400473 19:56083426-56083448 TTGGATCAGCAATTGATGTTTGG - Intergenic
925309476 2:2872257-2872279 TTCTCTCAGCTCCTGACGGTAGG + Intergenic
927615655 2:24591859-24591881 TCCCCACAGCTATTGATGGTGGG - Intronic
928006469 2:27566590-27566612 TTCTATAAGTAATTGATGTTGGG + Intronic
930249279 2:49017482-49017504 TTCTTACAGATATTGAAGGTTGG + Exonic
932826376 2:74944748-74944770 CTCTATCAGCGAGTGATGGGTGG + Intergenic
933380111 2:81531954-81531976 TTAAAGCAGCTATTGATTGTGGG - Intergenic
933385647 2:81607509-81607531 TTCCCTCAGCTATTCATGATGGG - Intergenic
937962800 2:127474519-127474541 TTCTATCAGTTATAGAAAGTGGG - Intronic
938255146 2:129852530-129852552 TTCACTCAGCTTTTGATGGTTGG - Intergenic
942436735 2:175986382-175986404 ATCTATCAGTTATTTATGGATGG - Intronic
942583836 2:177452253-177452275 TTCTGTCAGTTATTGAAGGGGGG + Intronic
943386248 2:187206859-187206881 TACTTTCAGCTTTTGATGGATGG - Intergenic
947512449 2:230769323-230769345 TTCTATCAATTATTGATAGTGGG - Intronic
1168730454 20:74075-74097 TTCTATCAACTGTTGAGAGTTGG - Intergenic
1168900102 20:1356337-1356359 TTCTATCAGTTAGTGATAGAAGG + Intronic
1169833218 20:9848630-9848652 TTCATTCATCTGTTGATGGTTGG - Intergenic
1170034766 20:11978777-11978799 TTTCATCTGCCATTGATGGTGGG + Intergenic
1172660372 20:36564125-36564147 TTCTATCTGTTATTGAAAGTGGG - Intergenic
1173876843 20:46378145-46378167 TTCTTTAAGCCATTGATGCTAGG - Intronic
1178324788 21:31635686-31635708 TTCTATCCACTATTGAAAGTGGG + Intergenic
1179636803 21:42717264-42717286 TTCTCTCAGCTTTTGCTGATTGG + Intronic
1180865765 22:19118729-19118751 TTTTCTCAGCTATGTATGGTGGG + Intronic
1183292522 22:37011392-37011414 TTCCATCAGCTATAGCTGGAAGG + Intronic
949647464 3:6112851-6112873 TTCTTTCAGCTTTTTAAGGTTGG + Intergenic
951909544 3:27735231-27735253 TTCTTTGAGCTGCTGATGGTTGG + Intergenic
954040256 3:47880945-47880967 TTCTATCAACTGTTCATAGTGGG + Intronic
958665391 3:97129894-97129916 GACTATCAGATATTGAGGGTGGG + Intronic
961140418 3:124551195-124551217 TCCCATCTGCTATTGTTGGTTGG - Intronic
963482193 3:145890122-145890144 TTGTGTCAGGTATTGATGATTGG - Intergenic
965468499 3:169061928-169061950 CACTCTCAGCTAATGATGGTGGG - Intergenic
968075489 3:195813837-195813859 TTCTGTCAGCTCTTGCTCGTGGG + Intergenic
968205785 3:196798834-196798856 TTCTATCAGCAATGGATACTGGG - Intronic
969283399 4:6186746-6186768 TTCTATCTGTTATTGAAAGTGGG + Intronic
970737227 4:19187211-19187233 TTCTATTAGCTATTTATGCATGG - Intergenic
975229139 4:71910242-71910264 TGCTATAATCTATTAATGGTTGG - Intergenic
979509210 4:121532732-121532754 AGCTATCAGCTATTGAGGGTAGG - Intergenic
981506916 4:145511959-145511981 TTCTCTCAGATTTTGATTGTTGG + Intronic
982644257 4:158003353-158003375 TTCTATCAGCTATTCCTTGTGGG - Intergenic
984235860 4:177157823-177157845 TTCTTTCATCTATTGTTTGTAGG - Intergenic
985910684 5:2878195-2878217 TTCTTTCAGGTTTTGATGGAGGG - Intergenic
986260108 5:6136953-6136975 TTCTCTCAGATACTGGTGGTGGG - Intergenic
988188238 5:27896227-27896249 TTCTGTCAGCTCTTAATGTTAGG + Intergenic
988281445 5:29152640-29152662 TGTTATCACTTATTGATGGTTGG - Intergenic
988391406 5:30638065-30638087 TTCTATCTGTTATTGAAGGTAGG + Intergenic
990296972 5:54411769-54411791 AAATACCAGCTATTGATGGTGGG + Intergenic
991600172 5:68344059-68344081 TTCTATCTGCTAATGGTGGCAGG + Intergenic
992484820 5:77184405-77184427 GTCTATAAACTATGGATGGTAGG + Intergenic
994008185 5:94866220-94866242 TTCTGTCAGCTATTTATACTGGG + Intronic
994901540 5:105778159-105778181 TTCTATCCATTATTGATAGTGGG + Intergenic
995151176 5:108847580-108847602 TTGTATCAGTTATTGATGGAAGG + Intronic
998280418 5:140801829-140801851 TAATAACAGCAATTGATGGTGGG + Exonic
999134502 5:149309582-149309604 TTCTAACAGCGATGGAGGGTTGG - Intronic
1003299789 6:4868699-4868721 GTCTATCAGTTATTGATAGTGGG + Intronic
1003313648 6:4991591-4991613 TTCTGTCAATTATTGAGGGTGGG + Intergenic
1003932338 6:10937006-10937028 ATCTATCGACTATTGAAGGTGGG - Intronic
1004485589 6:16063376-16063398 TCCTGTGTGCTATTGATGGTAGG + Intergenic
1007233155 6:40365659-40365681 TTGTATCAGTTATTGAGGGAAGG - Intergenic
1007920242 6:45602048-45602070 TTCTATCAGTTATTGAGAGTGGG - Intronic
1010844094 6:80683626-80683648 TTCTACCAGATTTTCATGGTAGG + Intergenic
1011541068 6:88429906-88429928 TTCTATCATTTATTGAAAGTGGG + Intergenic
1011575052 6:88788296-88788318 TTCTACCAGCCATTGAAGTTTGG - Intronic
1011979840 6:93359836-93359858 CTCTATCATCTATTGATCGATGG - Intronic
1014676726 6:124377016-124377038 TTCTATCACCCATTTAAGGTGGG + Intronic
1014806214 6:125832692-125832714 TTATATCAGCTTTGGCTGGTGGG + Intronic
1015027038 6:128547316-128547338 TTCTATAAGTTATTGATAGAGGG - Intergenic
1019615828 7:1960718-1960740 TTCTATCAGCTATTGAGAGAGGG - Intronic
1021124686 7:16837625-16837647 TTCTCTCAGCACTTGTTGGTAGG - Intergenic
1021796846 7:24264064-24264086 TTCTATCAGCAAATGAGGTTGGG + Intergenic
1022252298 7:28620527-28620549 TTCTCTCAGGTAGTGAAGGTAGG + Intronic
1023497922 7:40817510-40817532 TTATATCAACTATTGATGGAAGG + Intronic
1028804689 7:95011359-95011381 TTCTATGAGCTACTGATTGTAGG + Intronic
1029166027 7:98591681-98591703 TTAAATCAGCAAATGATGGTGGG - Intergenic
1036745056 8:11401364-11401386 TTATCTCAGGTATTGAAGGTTGG - Intronic
1038051420 8:23816888-23816910 TTCTATCAGTTATTGAGAGAGGG + Intergenic
1039041149 8:33410013-33410035 TGCTAGAAGCTATTGATGTTGGG - Intronic
1040427792 8:47306667-47306689 TTCTATCCACTATTGAAAGTAGG + Intronic
1041759826 8:61353135-61353157 TTCTATCAGTTGCTGAGGGTGGG - Intronic
1042653987 8:71075043-71075065 TTCTATCAAACATTGTTGGTAGG + Intergenic
1043524702 8:81083529-81083551 CCCTATCAGCTTTTGCTGGTAGG + Intronic
1043700550 8:83282403-83282425 TTCTATCCACTATTGAGTGTAGG + Intergenic
1043842183 8:85120271-85120293 TTCTATCAGTTGCTGATGCTTGG + Intronic
1044628329 8:94256080-94256102 TTTGATCAGATATTGAAGGTGGG - Intronic
1044759093 8:95498174-95498196 TTGTTTCAGCTATTGATGTCTGG - Intergenic
1045720985 8:105110655-105110677 ATCTCTCATCTATTGCTGGTGGG - Intronic
1046008887 8:108521479-108521501 TTCTACCTGTTATTGACGGTAGG + Intergenic
1047265649 8:123305876-123305898 TTCTATCCGTTATTGAGAGTGGG + Intergenic
1048369950 8:133768606-133768628 TTCAATCAGCTATTGAGTGATGG - Intergenic
1053567350 9:39267429-39267451 TTCTAGCCGCTATTGAGGTTTGG - Intronic
1053833075 9:42105162-42105184 TTCTAGCCGCTATTGAGGTTTGG - Intronic
1054129793 9:61351569-61351591 TTCTAGCCGCTATTGAGGTTTGG + Intergenic
1054597477 9:67082247-67082269 TTCTAGCCGCTATTGAGGTTTGG + Intergenic
1054713468 9:68534403-68534425 TTCTCTCACCTGTGGATGGTAGG - Intergenic
1058499450 9:105595825-105595847 ATCTATAAGCTATAGATGGGAGG - Intronic
1059094080 9:111393675-111393697 TTCTATCAGAAAATGATGGTAGG - Exonic
1059124693 9:111673356-111673378 TTCTATCATCTATTAACTGTTGG - Intergenic
1187121295 X:16409365-16409387 GTCTATCAGCAATTTATGCTAGG + Intergenic
1187185892 X:16984996-16985018 TTCATTCAGCTATTGCTGGGAGG + Intronic
1187498415 X:19816111-19816133 TTCTCTCATATATTGATGGTGGG - Intronic
1187959671 X:24556615-24556637 TTCTATCAGCTACAGATATTTGG + Intergenic
1189763533 X:44346206-44346228 TTCTTTCAGTTATGGTTGGTGGG + Intergenic
1190849527 X:54224887-54224909 TTCTATCAGTTATTAAAAGTGGG - Intronic
1191793656 X:64998679-64998701 TTCTATCAATTATTGAGAGTGGG + Intronic
1193160301 X:78220839-78220861 TTCTATCCACTATTGAAAGTAGG - Intergenic
1194362613 X:92972694-92972716 TTCTATCAATTATTGAAAGTGGG + Intergenic
1197446658 X:126558361-126558383 TTCTATCAGTTACTGAGAGTAGG - Intergenic
1199440088 X:147857918-147857940 ATCTATCAGCTTTTGCTGGCTGG - Intergenic
1200670867 Y:6088914-6088936 TTCTATCAATTATTGAAAGTGGG + Intergenic