ID: 1118526620

View in Genome Browser
Species Human (GRCh38)
Location 14:66651729-66651751
Sequence AAACCCTGCTTCACAAAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 291
Summary {0: 7, 1: 30, 2: 30, 3: 30, 4: 194}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118526620_1118526622 10 Left 1118526620 14:66651729-66651751 CCTGTCTTTGTGAAGCAGGGTTT 0: 7
1: 30
2: 30
3: 30
4: 194
Right 1118526622 14:66651762-66651784 CAGCAACCAAAATGAGATTATGG 0: 9
1: 11
2: 20
3: 22
4: 193

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118526620 Original CRISPR AAACCCTGCTTCACAAAGAC AGG (reversed) Intronic