ID: 1118526622

View in Genome Browser
Species Human (GRCh38)
Location 14:66651762-66651784
Sequence CAGCAACCAAAATGAGATTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 255
Summary {0: 9, 1: 11, 2: 20, 3: 22, 4: 193}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118526620_1118526622 10 Left 1118526620 14:66651729-66651751 CCTGTCTTTGTGAAGCAGGGTTT 0: 7
1: 30
2: 30
3: 30
4: 194
Right 1118526622 14:66651762-66651784 CAGCAACCAAAATGAGATTATGG 0: 9
1: 11
2: 20
3: 22
4: 193
1118526616_1118526622 23 Left 1118526616 14:66651716-66651738 CCATTGCCAACATCCTGTCTTTG 0: 1
1: 6
2: 27
3: 60
4: 310
Right 1118526622 14:66651762-66651784 CAGCAACCAAAATGAGATTATGG 0: 9
1: 11
2: 20
3: 22
4: 193
1118526615_1118526622 30 Left 1118526615 14:66651709-66651731 CCTGCTTCCATTGCCAACATCCT 0: 1
1: 19
2: 36
3: 54
4: 249
Right 1118526622 14:66651762-66651784 CAGCAACCAAAATGAGATTATGG 0: 9
1: 11
2: 20
3: 22
4: 193
1118526617_1118526622 17 Left 1118526617 14:66651722-66651744 CCAACATCCTGTCTTTGTGAAGC 0: 9
1: 27
2: 29
3: 37
4: 215
Right 1118526622 14:66651762-66651784 CAGCAACCAAAATGAGATTATGG 0: 9
1: 11
2: 20
3: 22
4: 193

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118526622 Original CRISPR CAGCAACCAAAATGAGATTA TGG Intronic