ID: 1118527892

View in Genome Browser
Species Human (GRCh38)
Location 14:66666429-66666451
Sequence TAAAGCCTATTTAACTCTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 433
Summary {0: 1, 1: 0, 2: 4, 3: 49, 4: 379}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118527892_1118527896 -3 Left 1118527892 14:66666429-66666451 CCACCAGAGTTAAATAGGCTTTA 0: 1
1: 0
2: 4
3: 49
4: 379
Right 1118527896 14:66666449-66666471 TTATCCCTGGGATGCAAACTTGG 0: 2
1: 31
2: 362
3: 1747
4: 11864

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118527892 Original CRISPR TAAAGCCTATTTAACTCTGG TGG (reversed) Intronic
902083952 1:13842709-13842731 TAAAGCCTACTTGACTGTGGTGG + Intergenic
903914059 1:26750348-26750370 TAATGCCAATTCTACTCTGGTGG + Intronic
904145077 1:28384006-28384028 TAAAGCCTACTTGATTGTGGTGG + Intronic
905232950 1:36526582-36526604 TAAAGACTTTTTAAATCTGTGGG - Intergenic
909442564 1:75714178-75714200 TAAAGCCTACTTGATCCTGGTGG - Intergenic
909689550 1:78391642-78391664 TAAAGCCTACTTGATTGTGGTGG + Intronic
909882810 1:80901360-80901382 TGAAGCCTATTTGATTGTGGTGG - Intergenic
910610588 1:89137452-89137474 TAAAGCCTAATTGACAGTGGTGG - Intronic
911310393 1:96285661-96285683 TAAAGCCTACTTGATTGTGGTGG + Intergenic
911667546 1:100571144-100571166 TAAAGCCTACTTGACTGTGATGG - Intergenic
911940701 1:104043950-104043972 TAAAGCCTACTTGATTCTGGTGG + Intergenic
912595073 1:110867365-110867387 TAAAGCCTATTTAATCATGGTGG - Intergenic
912794922 1:112687399-112687421 TAATTCCTATTTAACTCTTCAGG - Intronic
914968658 1:152286112-152286134 TAAAGCCTACTTGATTGTGGTGG - Intergenic
916593894 1:166223377-166223399 TAAAGCCTACTTAATCATGGTGG + Intergenic
917162212 1:172070444-172070466 TAAATCCTACTTAACTCTTTAGG + Intronic
917572626 1:176284603-176284625 TAAAGCCTATTTGATCATGGTGG + Intergenic
918249717 1:182691443-182691465 TAAAGCCTACTTAATCATGGTGG - Intergenic
918655582 1:187021947-187021969 TAAAGCCTACTTGATTGTGGTGG - Intergenic
918852669 1:189712159-189712181 TAAAGCCTATTTGGCTGTGGGGG - Intergenic
919254076 1:195098215-195098237 TAAAGCCTACTTGATTGTGGTGG + Intergenic
920935209 1:210426686-210426708 TAAAGCCTACTTGATTGTGGTGG + Intronic
921343255 1:214155271-214155293 TAAAGCCCCTTTAATTCTGGAGG + Intergenic
922623293 1:227009237-227009259 TGAAGTTTATTTAACTCTAGCGG - Intronic
923179809 1:231505626-231505648 TAGAGCCTACTTGACTATGGCGG + Intergenic
924630014 1:245728177-245728199 TGAAGCCTACTTGACTGTGGTGG - Intergenic
924645496 1:245873640-245873662 TAAAGCATTTTTATCTCTGTTGG - Intronic
924886680 1:248225777-248225799 TAAAGCCTACTTGATTGTGGTGG + Intergenic
1064397222 10:14991668-14991690 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1064400119 10:15014138-15014160 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1064913033 10:20424080-20424102 TAAAGCCTACTTGATTGTGGTGG + Intergenic
1066390402 10:34973491-34973513 AAGGGCCTATTGAACTCTGGGGG + Intergenic
1068218633 10:54014558-54014580 TAAAACCTACTTGACTGTGGTGG - Intronic
1068325495 10:55480675-55480697 TGAAGCCTATTTAATCATGGTGG + Intronic
1068449605 10:57168866-57168888 TAAAGCCTACTTGATTATGGTGG - Intergenic
1068832796 10:61516987-61517009 TAAAGCCTACTTGATTGTGGTGG + Intergenic
1069052940 10:63813146-63813168 TAAAGCCTACTTGATTGTGGTGG + Intergenic
1070360496 10:75683944-75683966 AAAAACCTATAAAACTCTGGTGG - Intronic
1070886948 10:79908912-79908934 TAAAGCCTACTTAACTGTGATGG + Intergenic
1071282221 10:84113206-84113228 AAAGGCCTGTTAAACTCTGGAGG + Intergenic
1071611413 10:87034738-87034760 TAAAGCCTACTTAACTGTGATGG + Intergenic
1071925854 10:90408467-90408489 GACAGCCTATTTGACTCTGTGGG - Intergenic
1072372886 10:94783297-94783319 TAAGGCCTATTTCAATCTGCAGG - Intronic
1072839625 10:98756978-98757000 TAAAGCCTACTTGATTGTGGTGG - Intronic
1074214553 10:111371601-111371623 TAAAGCCTACTTGATTATGGTGG - Intergenic
1074648799 10:115494684-115494706 TAAAGCCTACTTAATTGTGGTGG + Intronic
1076746246 10:132516149-132516171 CAAAGCCTCCTTGACTCTGGAGG + Intergenic
1077589034 11:3477521-3477543 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1077984508 11:7337708-7337730 TAAAGCCTACTTGATTGTGGTGG + Intronic
1079255968 11:18830361-18830383 TAAAGCCTACTTGATTATGGTGG + Intergenic
1079869961 11:25784836-25784858 TAAAGCCTGTTTGATTGTGGTGG - Intergenic
1081010069 11:37800017-37800039 TAAAGCCTATTTCATTGTGATGG - Intergenic
1081379560 11:42398164-42398186 TAAAGCCTAATTGACCGTGGTGG - Intergenic
1083097928 11:60271216-60271238 TAAAGCCTACTTGATTATGGTGG + Intergenic
1083507358 11:63170960-63170982 TAAAGCCTACTTAATCGTGGTGG - Intronic
1084244729 11:67849144-67849166 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1084827955 11:71745412-71745434 AAGAGCCTATTGAACTCTGGGGG + Intergenic
1084847464 11:71911683-71911705 AAGGGCCTATTGAACTCTGGGGG + Intronic
1085856035 11:80177234-80177256 TAAAGCCTACTTGATTGTGGTGG + Intergenic
1086234675 11:84614499-84614521 TAAAACCTATTTCTCTCTGTTGG - Intronic
1087373618 11:97316861-97316883 TTAAGCCTATTTAATTGTAGTGG + Intergenic
1087378830 11:97378749-97378771 TAAAGCCTACTTGATTATGGTGG - Intergenic
1088508097 11:110546056-110546078 TAAAGCCTACTTGATTATGGTGG - Intergenic
1088945443 11:114507539-114507561 TAAAGCCTACTTAATCATGGTGG - Intergenic
1089113927 11:116078808-116078830 AAAACCCTATTTAACCCTGTTGG + Intergenic
1089968782 11:122675684-122675706 TACATCCTGTTTATCTCTGGGGG - Intronic
1090193844 11:124799173-124799195 TCAAGCCAATCTAACTCTGGAGG + Intronic
1090573973 11:128080205-128080227 TAAAGCCTACTTGATTGTGGTGG - Intergenic
1090574172 11:128082676-128082698 TAAAGCCTACTTGACTGCGGTGG + Intergenic
1092415293 12:8286289-8286311 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1092432376 12:8419890-8419912 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1092680707 12:10977212-10977234 TAAAGCCTACTTGATTATGGTGG - Intronic
1093219745 12:16405709-16405731 TAAAGCCTATTTCATTGTGGTGG - Intronic
1093289298 12:17301616-17301638 AAAGGCCTGTTAAACTCTGGGGG + Intergenic
1093477223 12:19569487-19569509 TAAAGCCTACTTGACTGTGGTGG + Intronic
1093655702 12:21691869-21691891 TAAAGCCTAGTTAATCATGGTGG - Intronic
1094290134 12:28838808-28838830 TAAAGCCTACTTAATCATGGTGG - Intergenic
1095186103 12:39201604-39201626 TAAAGCCCATTTGATTGTGGTGG - Intergenic
1095259124 12:40078481-40078503 TAAGGCCTATTTGATTGTGGTGG + Intronic
1095616991 12:44202488-44202510 TAAAGCCTACTTGATTGTGGCGG + Intronic
1095713030 12:45310287-45310309 TAAAGCCAATTTAACTCAGAAGG + Intronic
1097337492 12:58399293-58399315 TAAAGCCTACTTGACTGTGATGG + Intergenic
1097761160 12:63466067-63466089 TGAAGCCTATTTGATTATGGTGG + Intergenic
1097776242 12:63649968-63649990 TAAAGCCTACTTGATTGTGGTGG - Intronic
1097802281 12:63927741-63927763 TAAAGCGTTTATAGCTCTGGGGG - Intronic
1098659022 12:73069563-73069585 TAAAGCTTATTTGATTGTGGTGG + Intergenic
1099130057 12:78817094-78817116 TAAAGCCTACTTAATCGTGGTGG - Intergenic
1101700117 12:107165735-107165757 TAGAGCCTATTAAACTGAGGAGG - Intergenic
1104292911 12:127485584-127485606 AAAGGCCTGTTGAACTCTGGGGG + Intergenic
1104552002 12:129765773-129765795 TAAAGTTTATTTAACTCATGAGG - Intronic
1104571853 12:129933073-129933095 TAAAGAATATGAAACTCTGGGGG + Intergenic
1106366608 13:29087445-29087467 TAAAGCCTACTTGATTGTGGTGG + Intronic
1106604875 13:31219243-31219265 TAAAGCCTACTTAACTGTGGTGG - Intronic
1107105687 13:36639938-36639960 TAAATGATATTTAACTCTGGTGG - Intergenic
1107544157 13:41421456-41421478 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1108111309 13:47076431-47076453 TAAAGGCTATTTGATTATGGTGG - Intergenic
1108839388 13:54593402-54593424 TAAAGCCTACTTGATTGTGGTGG - Intergenic
1109436020 13:62303818-62303840 TACAGCCTACTTGACTGTGGAGG + Intergenic
1110393177 13:74999666-74999688 TAAAGCCACTCTAACTTTGGGGG + Intergenic
1110467804 13:75822643-75822665 TTAAGTCTATTTCACTCTGATGG - Intronic
1110509576 13:76333706-76333728 TTAAGCCTATGTAACACTGGGGG - Intergenic
1110880823 13:80570028-80570050 TAAAGCCTATGTAACTCGCTGGG - Intergenic
1110954424 13:81536330-81536352 TAAAGCCTACTTGATTATGGTGG - Intergenic
1111123548 13:83883041-83883063 TGAATGTTATTTAACTCTGGAGG + Intergenic
1111313466 13:86519673-86519695 TAAAGCCTACTGGATTCTGGTGG + Intergenic
1112878650 13:104079111-104079133 GAACGCTTATTTAACGCTGGTGG + Intergenic
1114132173 14:19803579-19803601 TAAAGCCTACTTGATTGTGGTGG + Intronic
1114279095 14:21174123-21174145 TAAAGCCTACTTCACTGTGATGG - Intergenic
1115148618 14:30256923-30256945 TAAAGCCTACTTGACCATGGTGG + Intergenic
1116782810 14:49254705-49254727 TAAAGCCTACTTAATTATGGTGG - Intergenic
1117452011 14:55860852-55860874 TAAAGCCTACTTGATTGTGGTGG + Intergenic
1118527892 14:66666429-66666451 TAAAGCCTATTTAACTCTGGTGG - Intronic
1120448690 14:84637319-84637341 TAAAGCCTACTTGATTGTGGTGG + Intergenic
1122800639 14:104227789-104227811 AAAAGTCAATTTATCTCTGGTGG - Intergenic
1123585220 15:21754139-21754161 TTAAACCTATTTAACTCTACAGG + Intergenic
1123621867 15:22196746-22196768 TTAAACCTATTTAACTCTACAGG + Intergenic
1123780725 15:23624987-23625009 TAAAGCCTACTTGATTGTGGTGG + Intronic
1124450213 15:29781612-29781634 TAAAGCCTACTTGATTGTGGTGG - Intronic
1126046338 15:44644236-44644258 TAAAGCCTACTTGATTCTGTTGG - Intronic
1126520187 15:49584160-49584182 TAAAGCCTACTTGATTGTGGTGG - Intronic
1131959832 15:97777715-97777737 TAAAGCCTATTTGATCATGGTGG - Intergenic
1132078374 15:98842292-98842314 TAAAACTGATTTAACTCTGAGGG + Intronic
1135815650 16:25630295-25630317 TCAAGACTTTTTAAATCTGGAGG - Intergenic
1138258697 16:55596454-55596476 TAAAGCCTACTTGATTGTGGTGG - Intergenic
1140021258 16:71241184-71241206 TGAAGCTTATATAATTCTGGGGG - Intergenic
1140630149 16:76842387-76842409 TAAAGCCTACTTAATTATGGTGG + Intergenic
1141292843 16:82736280-82736302 TGAAACATGTTTAACTCTGGAGG + Intronic
1141798882 16:86293979-86294001 TATAGCGTGTTTACCTCTGGAGG + Intergenic
1143428340 17:6859165-6859187 TAAAGCCTACTTGATTGTGGTGG + Intergenic
1144052879 17:11512216-11512238 TAAAGCATCTTTATATCTGGAGG + Intronic
1145864846 17:28234496-28234518 AAGCGCCTATTGAACTCTGGGGG - Intergenic
1153369058 18:4293824-4293846 AAAAGCTTAATTATCTCTGGTGG - Intronic
1153462172 18:5348000-5348022 TAAAGCCTACTTGATTGTGGTGG - Intergenic
1154136060 18:11779309-11779331 TAATGCCTATTTGCCACTGGTGG - Intronic
1154392893 18:13957062-13957084 TAAAGCCTACTTGACTGTGGTGG - Intergenic
1155665961 18:28308651-28308673 TAAAGCCTACTTGATTGTGGTGG - Intergenic
1155815122 18:30297716-30297738 TAAAGCCTACTTGATTATGGTGG + Intergenic
1156340808 18:36209136-36209158 TAAAGCCTACTTGATTATGGTGG + Intronic
1156790146 18:40962752-40962774 TAAAGCATATTTAATTGTGGTGG - Intergenic
1158111434 18:53944419-53944441 AAATGCCCATTTAACTCTGCCGG + Intergenic
1158885828 18:61826143-61826165 TAAAGACTATTTTAAGCTGGAGG + Intronic
1159094944 18:63891689-63891711 TAAAGACATTTTAACTCAGGAGG + Intronic
1159189553 18:65024071-65024093 GACAGCATATATAACTCTGGTGG - Intergenic
1159804021 18:72933200-72933222 TAAATCCTTTTTAAATCTGGAGG + Intergenic
1160369379 18:78358894-78358916 TAACTCCTATACAACTCTGGAGG + Intergenic
1163966372 19:20750816-20750838 AAGGGCCTATTGAACTCTGGGGG - Intronic
1164481054 19:28611268-28611290 AAAGGCCTATTGAACTCTGGGGG + Intergenic
1166176144 19:41072267-41072289 TAAAGCCTATTTAATTGTGATGG + Intergenic
925647284 2:6048979-6049001 TAAAGCCTATTTGATCATGGTGG - Intergenic
928473703 2:31601708-31601730 TGAAGCCTACTTGACTATGGTGG - Intergenic
929257381 2:39827314-39827336 TGAAGCCGACTTAACTGTGGTGG + Intergenic
929382667 2:41370669-41370691 TAAAGCCTACTTGATTGTGGTGG - Intergenic
930518552 2:52435521-52435543 AAAGGCCTGTTGAACTCTGGGGG + Intergenic
930556384 2:52900924-52900946 TAAAGCCTACTTTATTGTGGTGG - Intergenic
931921518 2:67021616-67021638 TAAAGCCTACTTGATTGTGGTGG - Intergenic
931966706 2:67543457-67543479 TTCAGCCTCTTTAACTCTTGTGG - Intergenic
932349946 2:71023607-71023629 AAGGGCCTATTGAACTCTGGGGG + Intergenic
932658490 2:73631082-73631104 AATAGCCTTTTTAACTCTGAGGG - Intergenic
932665103 2:73691089-73691111 AATAGCCTTTTTAACTCTGAGGG - Intergenic
932853023 2:75205414-75205436 TAAAGCCTACTTGATTATGGTGG + Intergenic
933052762 2:77620361-77620383 TAAAGCCTACTTAATTATGGTGG - Intergenic
933477253 2:82806835-82806857 TAAAGCCTACTTGATTGTGGCGG - Intergenic
936479865 2:112876397-112876419 TAGAGATTATTGAACTCTGGAGG + Intergenic
936693161 2:114916621-114916643 TAAAGCCTACTTGACCGTGGTGG - Intronic
936847691 2:116856328-116856350 TAAAGCCTACTTGATTGTGGTGG - Intergenic
937728131 2:125191465-125191487 TGAAGCCTATTTGATTGTGGTGG + Intergenic
937823472 2:126338486-126338508 TAAAGCCTACTTCATTGTGGTGG - Intergenic
939199262 2:139014249-139014271 TAAAGCCTACTTAATTATGGTGG + Intergenic
940535241 2:154932813-154932835 TAAAGCCTATTTGATCATGGTGG + Intergenic
940869526 2:158848384-158848406 AAGGGCCTATTGAACTCTGGGGG + Intronic
940872202 2:158869382-158869404 AAGGGCCTATTGAACTCTGGGGG + Intergenic
940874409 2:158885370-158885392 AAGGGCCTATTGAACTCTGGGGG + Intergenic
941146243 2:161849745-161849767 TAAAGCCTATTTGATCATGGTGG + Intronic
941171821 2:162147126-162147148 TAAAGGCTATGTCACACTGGAGG + Intronic
941221874 2:162792128-162792150 TAAAGCCTATTTGATCATGGTGG + Intronic
941376808 2:164741325-164741347 AAAAGCCTACTTAATTTTGGAGG + Intronic
941392409 2:164930552-164930574 TAAAGCCTACTTGATTGTGGTGG - Intronic
942729047 2:179043492-179043514 TGAAGCCTATTTGATTGTGGTGG - Intronic
942741803 2:179189222-179189244 TAAAGCCTAATTGAATGTGGAGG - Intronic
942760553 2:179392024-179392046 TAAAGCCTATTTGATCATGGTGG - Intergenic
943152768 2:184135137-184135159 TAAAGCCTACTTGATTGTGGTGG + Intergenic
943167383 2:184347017-184347039 TAAAGCCTATTTGATTATGATGG + Intergenic
943316167 2:186390569-186390591 TAAAGCCTACTTGATTATGGTGG - Intergenic
943555917 2:189403761-189403783 TGAAGCCTACTTAATTGTGGTGG + Intergenic
944627616 2:201588290-201588312 TAAAGCCTACTTGACAGTGGTGG - Intronic
945342882 2:208678566-208678588 TAAAGCCTACTTGATTGTGGTGG + Intronic
945650508 2:212552776-212552798 TAATGCCTAATTAACTCAGTTGG + Intergenic
946121084 2:217515476-217515498 TAAAGCCTATTGCAGTTTGGAGG - Intronic
947416016 2:229897186-229897208 TAAACCCTTTTTCACTATGGAGG - Intronic
947595003 2:231405528-231405550 AAGGGCCTATTGAACTCTGGGGG + Intergenic
1169678335 20:8180297-8180319 TAAAGCCTATTTGATCATGGTGG + Intronic
1169795117 20:9454017-9454039 TAAATGCTATTTAATTTTGGAGG - Intronic
1171158714 20:22901323-22901345 TAAAGCCTACTTGATTGTGGGGG - Intergenic
1171239851 20:23557128-23557150 TAAAGCCTACTTAAGTGTGATGG + Intergenic
1171408547 20:24930246-24930268 AAGGGCCTATTGAACTCTGGGGG + Intergenic
1177346717 21:19882784-19882806 GAAAGCATATTTAAATTTGGAGG - Intergenic
1177570916 21:22885739-22885761 TAAAGCAAATGTAAATCTGGAGG + Intergenic
1177693281 21:24538223-24538245 TAAAGCCTAATTAACATTGTTGG - Intergenic
1180192928 21:46175954-46175976 TAAAACCTATTTGATTGTGGTGG - Intronic
1181884637 22:26010527-26010549 TAAAGTCTATTTAACGGTGGAGG - Intronic
1182928012 22:34145265-34145287 TAAAGCCTATTTGATCATGGTGG + Intergenic
1184364110 22:44038419-44038441 TAAAGCCTACTTAACTCATAGGG + Intronic
1184900197 22:47441901-47441923 TAAAGACTATTTAACTGAGTGGG - Intergenic
949158118 3:851155-851177 AAAGGCCTGTTGAACTCTGGGGG + Intergenic
949696548 3:6703056-6703078 TAAAGCCTACTTGATTGTGGTGG - Intergenic
949884564 3:8682968-8682990 AAAGGCCTATTTAACTCTGGGGG + Intronic
951859312 3:27233916-27233938 TGAAGCCTACTTCACTGTGGTGG - Intronic
952216580 3:31284130-31284152 TACAGCCTAGTTTACTATGGTGG + Intergenic
952670054 3:35955476-35955498 CAAAGCCACTTTAACTTTGGTGG + Intergenic
954724105 3:52592507-52592529 TAAAGCCTACTTGACCATGGTGG + Intronic
957022501 3:75140957-75140979 AAAGGCCTATTGAACTCTGGGGG + Intergenic
957076184 3:75604895-75604917 AAGGGCCTATTGAACTCTGGGGG - Intergenic
957973090 3:87407771-87407793 TGAAGCCTATTTGATTGTGGTGG - Intergenic
958727725 3:97926216-97926238 TAAAGCCTACTTGATTGTGGTGG - Intronic
959113382 3:102148222-102148244 TAAAGCCTATTTGATAGTGGTGG + Intronic
959128451 3:102320146-102320168 TAAAGCCTACTTGATTGTGGTGG + Intronic
960193876 3:114741479-114741501 TATAACCTATTAAACACTGGTGG + Intronic
960255971 3:115512052-115512074 TAAAGACTCTCTTACTCTGGAGG + Intergenic
960782468 3:121334637-121334659 TAAAGCCTACTTGATTGTGGTGG - Intronic
960868203 3:122223837-122223859 TAAAGCCTATTTGATTGTGGTGG - Intronic
962335295 3:134524725-134524747 TGAAGCCTACTTGACTGTGGTGG + Intronic
962762013 3:138523021-138523043 TAAAGCCCACTTGACTATGGTGG - Intronic
963439130 3:145314813-145314835 GAAAACATATTTTACTCTGGTGG - Intergenic
964296204 3:155236388-155236410 TAAAGCCTACATGACTGTGGTGG + Intergenic
964922859 3:161919030-161919052 TAAAGCCTACTTGATTGTGGTGG + Intergenic
965257406 3:166432039-166432061 AAAAGCCATTTTAACTGTGGTGG - Intergenic
965636117 3:170782650-170782672 TAAAGCCTACTTGACCATGGAGG - Intronic
966000215 3:174940354-174940376 TGAAGCCCATTTAATTGTGGTGG + Intronic
966361953 3:179139355-179139377 TAAAGCCTACTTGATTGTGGTGG - Intergenic
966386007 3:179398826-179398848 TAAAAACTATTTAACACTTGTGG - Intergenic
967554538 3:190839238-190839260 TAAAGCCTACTTAATCATGGTGG - Intergenic
967638971 3:191838303-191838325 TAAAGCCAACTTGACTGTGGTGG - Intergenic
969024340 4:4161595-4161617 AAAGGCCTATTGAACTCTTGGGG - Intergenic
969729477 4:8945570-8945592 AAGCGCCTATTGAACTCTGGGGG + Intergenic
969789067 4:9479509-9479531 AAGGGCCTATTGAACTCTGGGGG + Intergenic
969793804 4:9510277-9510299 AAGGGCCTATTGAACTCTGGGGG + Intergenic
970647848 4:18143592-18143614 TAAGGCATATTTATTTCTGGTGG - Intergenic
972030985 4:34457981-34458003 TAAATCTTATTTAAAACTGGAGG + Intergenic
972989801 4:44810952-44810974 TGAAGCCTATTTAACTGTGGTGG + Intergenic
973129485 4:46632859-46632881 TAAAGCCTACTTCATTGTGGTGG + Intergenic
973617629 4:52695268-52695290 TAAAGCCTACTTGATTGTGGTGG - Intergenic
974094572 4:57349295-57349317 TAAAGCCTACTTGATTGTGGTGG + Intergenic
974769431 4:66391699-66391721 TAAAGCCTATTTAAATGTAAAGG + Intergenic
974930904 4:68359862-68359884 AAATGCCCATGTAACTCTGGAGG - Intergenic
975403078 4:73959792-73959814 TAAAGCCTACTTAATTGTGGTGG + Intergenic
976640391 4:87331596-87331618 TAAAGCCTACTTGACTGTGGTGG + Intergenic
976948156 4:90795839-90795861 TAAAGCCTACTTGATTATGGTGG + Intronic
977696851 4:99975325-99975347 TAAAGCCTACTTGATTGTGGTGG - Intergenic
978709913 4:111767360-111767382 TAAAGCCTACTTGATTGTGGTGG + Intergenic
979152608 4:117339435-117339457 TAAAGCCTACTTGATTGTGGTGG + Intergenic
979770410 4:124517640-124517662 TAAAACCTGTTTAATTCTAGAGG + Intergenic
980257336 4:130399207-130399229 TAAAGCATATTTAATAGTGGTGG + Intergenic
980456457 4:133050069-133050091 TAAAGCCTACTTGATTGTGGTGG - Intergenic
981287065 4:143030161-143030183 TAAAGCCTACTTGATTGTGGTGG - Intergenic
981388618 4:144161142-144161164 TAAAGCCTAGTTAATTGTGATGG + Intergenic
981453759 4:144929936-144929958 TAAAGCCTACTTGATTGTGGTGG + Intergenic
981718451 4:147775295-147775317 TAAAGCCTATTTATTTCTAAAGG - Intronic
982632924 4:157855093-157855115 TAAAGCCTACTTAGTTGTGGTGG + Intergenic
982646479 4:158030171-158030193 TAAAGCCTACTTGATTGTGGTGG - Intergenic
983146060 4:164216011-164216033 TAATGCCTATATAATTCTTGAGG + Intronic
986217616 5:5734841-5734863 TAAAGCCTACTTGATTGTGGTGG + Intergenic
986229364 5:5848117-5848139 TAAAGCCTACTTAATCATGGTGG + Intergenic
986883485 5:12205149-12205171 TAAAGCCTACTTGATTGTGGAGG + Intergenic
987159680 5:15128907-15128929 TAAAGTCTACTTAATTGTGGTGG + Intergenic
988034213 5:25804549-25804571 TAAAGCCTATTTGAGTGTAGTGG + Intergenic
988645489 5:33091094-33091116 TAAAGCCTACTTTATTGTGGTGG + Intergenic
989693652 5:44173811-44173833 TAAAGCCTACTTGATCCTGGTGG - Intergenic
989768961 5:45119660-45119682 TGAAGCCAATTTGACTGTGGTGG - Intergenic
991158188 5:63463002-63463024 TGAAGCCTACTTGACTGTGGTGG - Intergenic
991526804 5:67567943-67567965 TAAAGCCTATTTGATCATGGTGG - Intergenic
992305623 5:75434344-75434366 TAAAGCCTACTTGATTGTGGTGG + Intronic
992384132 5:76267459-76267481 TCATGCCTTTTTAACTGTGGAGG + Intronic
992976089 5:82121806-82121828 TAAAGCCTACTTGATTGTGGTGG + Intronic
993263875 5:85696386-85696408 TAAAGCCTATTTGATTGTGGTGG - Intergenic
993272803 5:85816832-85816854 TAAAGCCTATTCAACTTTCCTGG + Intergenic
993281082 5:85925093-85925115 TAAAGCCTACTTGATTGTGGTGG - Intergenic
993878107 5:93332172-93332194 TAAAGCCTTTTTAAATCTACAGG + Intergenic
994262403 5:97675433-97675455 TAAAGCCTATTTGATTTTGGTGG - Intergenic
994650785 5:102524612-102524634 TAAAGCCTATTTGATCATGGTGG - Intergenic
995576619 5:113543161-113543183 TAAGGTATATTTAAATCTGGGGG - Intronic
996046265 5:118877024-118877046 TAAAGCCTACTTGATTATGGTGG - Intronic
996195602 5:120602908-120602930 TAAAGCCTACTTAATCATGGTGG + Intronic
996663500 5:126031080-126031102 TAAAGCCTACTTAATCATGGTGG - Intergenic
998410020 5:141902809-141902831 TAAAGCTAATTTAACACTGGGGG + Intergenic
998642510 5:144027208-144027230 TAGAGCCTTGTTAACCCTGGAGG - Intergenic
1000737655 5:164925658-164925680 TAAAGCCTACTTGACTGTGGTGG + Intergenic
1003249098 6:4409534-4409556 TGAAGCCAATTTAATTATGGGGG - Intergenic
1004092967 6:12524208-12524230 TAAAGCCTACTTAATTGTGGTGG + Intergenic
1004299634 6:14445542-14445564 TAGAGCGTAATTAACTCGGGAGG - Intergenic
1005283049 6:24295119-24295141 TAAAGCCTATTTGATCATGGTGG - Intronic
1005312537 6:24572153-24572175 TTAAGGTTATTTAACTCAGGAGG + Intronic
1005786907 6:29252971-29252993 TAAAGCCTACTTGATTGTGGTGG - Intergenic
1006013057 6:31058224-31058246 TAAAGCCTCGTTAATTCTTGCGG + Intergenic
1008823493 6:55662526-55662548 TAAAGCCTATTTGATCATGGTGG + Intergenic
1008951921 6:57171233-57171255 TAAATCCTAATTAACTCTTGGGG - Intergenic
1009446462 6:63748331-63748353 TAAAGCCTACTTGATTTTGGTGG + Intronic
1010547078 6:77172386-77172408 TAAAGCCTACTTGACTGTGGTGG + Intergenic
1010708059 6:79137822-79137844 TACAGCCTACTCAACTGTGGTGG - Intergenic
1011565351 6:88666944-88666966 AAAGGCCTATTGAACTCAGGGGG + Intronic
1012067449 6:94566138-94566160 TCAAGCTTATCTAACTTTGGTGG + Intergenic
1012150394 6:95743031-95743053 TAAAGCATCTTTGTCTCTGGAGG + Intergenic
1012250970 6:96980505-96980527 TAAAGCCTACTTGATTGTGGTGG + Intronic
1012611689 6:101227133-101227155 AAAGGCCTGTTGAACTCTGGGGG - Intergenic
1012871239 6:104674867-104674889 TGAAGCCTATTTGATTGTGGTGG - Intergenic
1013081032 6:106813236-106813258 TAAAGCCTACTTGATTGTGGTGG - Intergenic
1015083450 6:129256886-129256908 TATAGCATATCTTACTCTGGTGG + Intronic
1015906755 6:138125083-138125105 TTAAGCCTATTTGATTGTGGTGG - Intergenic
1016125865 6:140402465-140402487 TAAAACCAATCTAACCCTGGTGG - Intergenic
1016227642 6:141759732-141759754 TAAATCCTACTTCACTGTGGTGG + Intergenic
1016498801 6:144694231-144694253 TAAAGCCTACTTGATTGTGGTGG + Intronic
1017601611 6:156089334-156089356 TAAAGCCTATTTGATTGTGCTGG - Intergenic
1019031276 6:169015028-169015050 TAAAGCCTACTTGATTGTGGTGG + Intergenic
1019758386 7:2790018-2790040 TAAAGCCTGCTCAACTCTGCAGG + Intronic
1020307021 7:6843222-6843244 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1020311497 7:6872066-6872088 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1020323065 7:6954404-6954426 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1021004700 7:15379808-15379830 TAAAGCCCATTTAATCATGGTGG - Intronic
1021135556 7:16960569-16960591 TGAAGCCTACTTGACTATGGTGG + Intergenic
1021363572 7:19747623-19747645 TTCAGCCTTTTTAACTCTAGAGG + Intronic
1022075929 7:26970510-26970532 TGAAGCCTATTTGATTGTGGTGG + Intronic
1022935152 7:35167562-35167584 TAAAGCCTACTTGATTGTGGTGG - Intergenic
1023458947 7:40373229-40373251 TAATGCCTATTTAATTCTCTGGG + Intronic
1024106417 7:46092193-46092215 TAAAGCCTGTTTGATTGTGGTGG + Intergenic
1024848479 7:53679775-53679797 TAAAGCCTACTTGATTGTGGTGG + Intergenic
1024858394 7:53808710-53808732 TAAAGATTATTTTGCTCTGGAGG + Intergenic
1025966844 7:66281172-66281194 TAAAGCCTACTTGATTGTGGTGG + Intronic
1028353144 7:89874264-89874286 TAAAGCCTACTTTATTGTGGTGG + Intergenic
1028858200 7:95616337-95616359 TAAAGCCTACTTGATTGTGGTGG - Intergenic
1029078175 7:97952166-97952188 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1029638940 7:101806014-101806036 TAAAGCCTGTATCAGTCTGGTGG - Intergenic
1029831102 7:103260338-103260360 TAAAGCCTACTTGATTGTGGTGG - Intergenic
1030403557 7:109083307-109083329 TGAAGCCTATCTGACTGTGGTGG - Intergenic
1030718750 7:112843925-112843947 TAAAGCCTACTTGACTGTGGTGG - Intronic
1030732264 7:113004214-113004236 TAAAGCCCATATACCTCTGAAGG + Intergenic
1030826415 7:114164762-114164784 AAAAGCCTATTTAAATTTGGTGG + Intronic
1031149303 7:118034680-118034702 TAAATCCTATTGGACTCTAGTGG + Intergenic
1031225554 7:119033474-119033496 TAAAGCCTACTTGATTGTGGTGG + Intergenic
1031368533 7:120935087-120935109 GAAAGCCTATTTTTCTGTGGAGG + Intergenic
1031669204 7:124522009-124522031 TAAAGCCTACTCGACTGTGGTGG + Intergenic
1031738165 7:125393821-125393843 TAAATCCCACTTAACTGTGGTGG - Intergenic
1031772538 7:125862789-125862811 TAAAGCCTACTTAATTATGGTGG + Intergenic
1032170776 7:129582843-129582865 AAAGGCCTGTTGAACTCTGGGGG + Intergenic
1032977056 7:137237540-137237562 TAAAAATTATTTAATTCTGGAGG - Intronic
1033494016 7:141875934-141875956 TAAAGCCTACTTGACTGTGGAGG + Intergenic
1033772501 7:144568007-144568029 TTCAGTCTATTTCACTCTGGGGG - Intronic
1033960996 7:146913128-146913150 TAAAGCATAATTAACTTTCGAGG - Intronic
1034366597 7:150554929-150554951 TAAAGCCTACTTGACCATGGTGG - Intergenic
1035481225 7:159187408-159187430 TAAAGCCTACTTGACTGTGGTGG - Intergenic
1036239833 8:7072337-7072359 AAGGGCCTATTGAACTCTGGGGG + Intergenic
1036903500 8:12689228-12689250 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1038799128 8:30733386-30733408 AAGGGCCTATTGAACTCTGGGGG + Intronic
1039278388 8:35956286-35956308 AAAGGCCTATTAAACTCTGGGGG + Intergenic
1040961798 8:53042221-53042243 TAAAGCCTACTTGATTGTGGTGG + Intergenic
1041017436 8:53605294-53605316 TAAAGCCTACTTGATCCTGGTGG - Intergenic
1041549696 8:59086302-59086324 TAAACCTTATTTGACTCTTGGGG + Intronic
1042108310 8:65352438-65352460 TAAAGCCTACTTAATTATGGTGG + Intergenic
1042854223 8:73249264-73249286 TAAAGCCTACTTAATTGTGGTGG + Intronic
1044262547 8:90144027-90144049 TAAATCCCATCTATCTCTGGTGG - Intergenic
1044272181 8:90259130-90259152 CAAAGCCTACTTAATTGTGGTGG - Intergenic
1044418717 8:91966400-91966422 TAAAGGCTGTTTTAATCTGGGGG + Intronic
1045676246 8:104611043-104611065 TAAAGCCTACTTGATTATGGTGG + Intronic
1046977942 8:120303580-120303602 TGAAGCCTACTTGACTGTGGTGG + Intronic
1048701439 8:137094932-137094954 TAAAGCCTACTTCATTGTGGTGG - Intergenic
1050485586 9:6131254-6131276 TAAAGCCTACTTGATTATGGTGG - Intergenic
1051833024 9:21301934-21301956 TAAAGCCTATTTAATTGTGGTGG - Intergenic
1051852297 9:21523475-21523497 TAAAGCCTACTTGATTGTGGTGG + Intergenic
1051861563 9:21630892-21630914 TAAAGCCTACTTGATTGTGGTGG - Intergenic
1052520037 9:29534978-29535000 TAAAGCCTACTTGATCCTGGTGG - Intergenic
1053531154 9:38882811-38882833 TAAAGCCTACTCAATTATGGTGG - Intergenic
1053542581 9:38990039-38990061 TAAAGCCTATTTGATAGTGGTGG + Intergenic
1053807036 9:41813556-41813578 TAAAGCCTATTTGATAGTGGTGG + Intergenic
1054203376 9:62107243-62107265 TAAAGCCTACTCAATTATGGTGG - Intergenic
1054623556 9:67373871-67373893 TAAAGCCTATTTGATAGTGGTGG - Intergenic
1054634986 9:67481121-67481143 TAAAGCCTACTCAATTATGGTGG + Intergenic
1055299660 9:74869962-74869984 GATAGCCTGTTTAGCTCTGGAGG + Intronic
1055341216 9:75285543-75285565 TAAAGCCTACTTGATTGTGGTGG + Intergenic
1056824279 9:89865862-89865884 TAAAGCCAATTTGTCTCAGGTGG - Intergenic
1056917169 9:90756062-90756084 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1057985149 9:99705758-99705780 TAAAGCCTATTTTCCTAGGGTGG - Intergenic
1058403207 9:104641058-104641080 TAAAGCCTAGTTGATTGTGGTGG - Intergenic
1059208724 9:112490677-112490699 AAAAGCCTATTAAACTTTGTTGG - Intronic
1059473201 9:114522886-114522908 GAAAGCCTGTTTGAATCTGGGGG - Intergenic
1059778703 9:117503816-117503838 TAAAGCCTACTTGATTGTGGTGG + Intergenic
1059834572 9:118136829-118136851 ACAAGCCTATTTAAATCTGAAGG - Intergenic
1060169326 9:121448048-121448070 TTAAGTCTTTCTAACTCTGGGGG + Intergenic
1061140617 9:128764029-128764051 TAAGTCCTAGTTAACTCTGGTGG + Intronic
1062224082 9:135439214-135439236 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1186679488 X:11856352-11856374 TGAAGCCTACTTAATTGTGGTGG - Intergenic
1186702216 X:12103775-12103797 TAAACTCTAATTATCTCTGGTGG - Intergenic
1187620615 X:21049350-21049372 TAAAGCCTACTTAATCTTGGTGG - Intergenic
1188218957 X:27516144-27516166 TAAAGCCTTGTTTACTCTGTGGG - Intergenic
1188717668 X:33480239-33480261 TAAAGCCTACTTAATCATGGTGG - Intergenic
1188795305 X:34457609-34457631 TAAAACCTATGAACCTCTGGAGG + Intergenic
1188843196 X:35041062-35041084 TGAAGCCTACTTAATTGTGGTGG - Intergenic
1189537693 X:41953679-41953701 TAAAGCCTATTTAATTCCCATGG + Intergenic
1189557350 X:42159086-42159108 TAAAGCCTACTTGACTGTGGTGG + Intergenic
1191020595 X:55856228-55856250 TAAAGCCTAGTTTACCATGGTGG + Intergenic
1191062461 X:56314115-56314137 TGCAGCCTAATTAACTCTTGTGG + Intergenic
1191651683 X:63545110-63545132 TAAAGCCTACTTAATTGTGGTGG - Intergenic
1192311365 X:70017497-70017519 TAAAGCCTACTTGATTGTGGTGG - Intronic
1192849500 X:74939874-74939896 TAAAGCCTACTTAATCCTGGTGG + Intergenic
1192867051 X:75145376-75145398 TAAAGCCTACTTGATTGTGGTGG - Intronic
1192886909 X:75345088-75345110 TGAAGCCTATTTGATTGTGGTGG + Intergenic
1193207943 X:78771129-78771151 TAAAACATATTTACCTCTGTGGG + Intergenic
1193230572 X:79040652-79040674 TGAAGCCTATTTAATCATGGTGG + Intergenic
1193275856 X:79586815-79586837 TAAAGCCTACTTAATTGTGATGG + Intergenic
1193518441 X:82499636-82499658 TAAAGCCTACTTTATTGTGGTGG + Intergenic
1193584019 X:83298576-83298598 TAAAGCCTACTTGATTGTGGTGG - Intergenic
1193701377 X:84765888-84765910 TAAAACCTACTTGACTGTGGTGG + Intergenic
1193844516 X:86452170-86452192 TAAAGCCTACTTGATTATGGTGG + Intronic
1193881850 X:86932933-86932955 TAAAGCCTACTTGATTGTGGTGG + Intergenic
1193961343 X:87928565-87928587 TAAAGCCTACTTGATTATGGTGG - Intergenic
1194357505 X:92903866-92903888 TAAAGCCTACTTGATTATGGTGG - Intergenic
1194610081 X:96033018-96033040 GAGAGCCTAGTTAAGTCTGGAGG - Intergenic
1194781088 X:98026623-98026645 TAAAGCCTACTTGATTGTGGAGG + Intergenic
1195104385 X:101589624-101589646 TAAAGCCTACTTGATTGTGGTGG + Intergenic
1195500347 X:105590701-105590723 TAAAGCCTACTTGATTGTGGTGG + Intronic
1195568602 X:106374193-106374215 TAAAGCCTACTTGATTGTGGTGG - Intergenic
1196473418 X:116054809-116054831 TAAAGCCTATTTGATCATGGTGG + Intergenic
1196475136 X:116075335-116075357 TAAAGCCTACTTGATTGTGGTGG - Intergenic
1196475143 X:116075454-116075476 TAAAGCCTACTTGATTGTGGTGG - Intergenic
1197076519 X:122360100-122360122 TAAAGCCTACTTGATTGTGGTGG + Intergenic
1197142692 X:123133723-123133745 TAAAGCCTACTTAATCATGGTGG - Intergenic
1197366525 X:125570504-125570526 TAAAGCCTACTTAATTGTGGTGG - Intergenic
1197370278 X:125618030-125618052 TAAAGCCTACTTGATTGTGGTGG + Intergenic
1197399515 X:125973390-125973412 TAAAGCCTACTTGATTGTGGTGG - Intergenic
1197402669 X:126010745-126010767 TAAAGCCTATTTGATTGTAGTGG - Intergenic
1197553233 X:127920877-127920899 TAAAGCCTACTTAATAATGGTGG - Intergenic
1197971049 X:132115301-132115323 TCAAGGCTATTTAAATATGGTGG + Intronic
1198136331 X:133754634-133754656 TTAAGCCTGTTTAGCCCTGGAGG + Intronic
1199905350 X:152223134-152223156 TACAGCTTTTTCAACTCTGGGGG - Intronic
1199913290 X:152311354-152311376 TAAAGCCTAGTTGATTGTGGTGG - Intronic
1200665682 Y:6019475-6019497 TAAAGCCTACTTGATTATGGTGG - Intergenic