ID: 1118529988

View in Genome Browser
Species Human (GRCh38)
Location 14:66693613-66693635
Sequence CTATTTCGGTCCCCTCTAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 42
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 35}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118529984_1118529988 13 Left 1118529984 14:66693577-66693599 CCAGCTCCAGAAGAGAGAGGAAA 0: 2
1: 11
2: 60
3: 173
4: 652
Right 1118529988 14:66693613-66693635 CTATTTCGGTCCCCTCTAATTGG 0: 1
1: 0
2: 0
3: 6
4: 35
1118529983_1118529988 14 Left 1118529983 14:66693576-66693598 CCCAGCTCCAGAAGAGAGAGGAA 0: 2
1: 12
2: 65
3: 222
4: 768
Right 1118529988 14:66693613-66693635 CTATTTCGGTCCCCTCTAATTGG 0: 1
1: 0
2: 0
3: 6
4: 35
1118529985_1118529988 7 Left 1118529985 14:66693583-66693605 CCAGAAGAGAGAGGAAATAGCCT 0: 1
1: 0
2: 0
3: 28
4: 256
Right 1118529988 14:66693613-66693635 CTATTTCGGTCCCCTCTAATTGG 0: 1
1: 0
2: 0
3: 6
4: 35

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118529988 Original CRISPR CTATTTCGGTCCCCTCTAAT TGG Intronic
903517407 1:23920972-23920994 CCATTTCGGTCTGCTCTATTGGG - Intergenic
905992840 1:42354501-42354523 CCATTTCGCACCCATCTAATTGG + Intergenic
911553014 1:99306836-99306858 CAATTTCGCTGCCCTCTACTGGG - Exonic
912113643 1:106374814-106374836 CTCTTTCTGTACCCTTTAATAGG + Intergenic
916090047 1:161300854-161300876 CTCTTTCTTTCCCCTCAAATAGG + Intergenic
920533941 1:206725091-206725113 CTACATCCGTCTCCTCTAATGGG + Intronic
1075470465 10:122685146-122685168 CTATTTCTCTCCCCTGTACTGGG + Intergenic
1081048041 11:38300165-38300187 CTATTTCTGTGCTCTCTATTTGG + Intergenic
1084138965 11:67210587-67210609 CTATTTCTGAGCCCTCTCATAGG - Intronic
1090382049 11:126334200-126334222 CTGTTTCTGTCCCCTATACTGGG - Intronic
1091981026 12:4864101-4864123 CTATTTGTGTCCCCTTTATTGGG - Intergenic
1092303299 12:7273353-7273375 CTCTTTGTGTCCCCTCTCATTGG + Intergenic
1092899674 12:13046351-13046373 CTTTTTGGCTCCCCTGTAATTGG + Intronic
1093560611 12:20534388-20534410 CTATTTTGGTCCTCTTCAATAGG + Intronic
1097227155 12:57484377-57484399 CTAGTTAGGGCCCCTCTAATGGG - Intronic
1111393052 13:87624615-87624637 TTACCTCGCTCCCCTCTAATTGG - Intergenic
1118529988 14:66693613-66693635 CTATTTCGGTCCCCTCTAATTGG + Intronic
1138850397 16:60622252-60622274 CTATTTCTGTCCTGTCTCATGGG + Intergenic
1140568017 16:76066873-76066895 CTATATGGATCTCCTCTAATGGG - Intergenic
1150676388 17:67247977-67247999 ATATTTAGGTCCCCTCAAAGAGG + Intergenic
1161139146 19:2637648-2637670 CTAATTCCGTCCCCTCTACTGGG + Intronic
933749725 2:85595588-85595610 CTAATTCGGCCCCCTCTCATTGG - Intergenic
940654463 2:156471292-156471314 CTATTTCATTGCCCTCTAATTGG + Intronic
942830073 2:180229208-180229230 CTTTTTTGGCCACCTCTAATAGG + Intergenic
942862318 2:180629756-180629778 CTATTCCAGTCCTCTCTCATTGG - Intergenic
1175163711 20:57028204-57028226 CTCTCTCTGTCCCCTGTAATTGG - Intergenic
965656021 3:170985802-170985824 CTATTTCTGTCCTTTCCAATGGG - Intergenic
971317090 4:25576629-25576651 CTATTTCAGTAGCCTCTAATTGG + Intergenic
994767998 5:103945354-103945376 CTATTTCAGTCCCATTTAAAAGG + Intergenic
996799278 5:127385060-127385082 TTATTTTGGTCTCCTCTAAAAGG + Intronic
997716810 5:136048717-136048739 CTATTACTCTCCCCTCTACTGGG - Intronic
998364170 5:141618429-141618451 CTTTTTTGGTCCCCTCTTCTGGG - Intronic
1010808647 6:80269950-80269972 ATATTTTTGTCCCCTTTAATAGG - Intronic
1017740765 6:157404601-157404623 CTATTTTTATCCCCTCAAATGGG - Intronic
1036486658 8:9185532-9185554 CTAATTCTGTCCCCTCCACTTGG + Intergenic
1043348885 8:79334976-79334998 GTATTCCGCTCCCCTCTAATTGG - Intergenic
1043630788 8:82329757-82329779 CTATTTCAGTCTCCTGAAATGGG - Intergenic
1048023831 8:130566005-130566027 CCATTTGGGTCAGCTCTAATTGG + Intergenic
1048482217 8:134808986-134809008 CTACTTCTGTCACCTCTAACAGG + Intergenic
1189763018 X:44342375-44342397 CTAATTCCCTCCCATCTAATTGG + Intronic
1193699446 X:84743871-84743893 ATATTTCCCTCCCCTCTAACTGG + Intergenic
1193853619 X:86571254-86571276 CTATTTCTGGACCCTCTATTAGG + Intronic