ID: 1118533909

View in Genome Browser
Species Human (GRCh38)
Location 14:66737229-66737251
Sequence AAGGGGAAAAAGAAAGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4220
Summary {0: 2, 1: 6, 2: 35, 3: 530, 4: 3647}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118533909_1118533913 -5 Left 1118533909 14:66737229-66737251 CCTTCCTCTTTCTTTTTCCCCTT 0: 2
1: 6
2: 35
3: 530
4: 3647
Right 1118533913 14:66737247-66737269 CCCTTCCCTTTCCCCTCTTTCGG 0: 1
1: 0
2: 3
3: 49
4: 465
1118533909_1118533922 28 Left 1118533909 14:66737229-66737251 CCTTCCTCTTTCTTTTTCCCCTT 0: 2
1: 6
2: 35
3: 530
4: 3647
Right 1118533922 14:66737280-66737302 GAATGGAGTTCATTCCTTCATGG 0: 1
1: 0
2: 1
3: 26
4: 287
1118533909_1118533915 -4 Left 1118533909 14:66737229-66737251 CCTTCCTCTTTCTTTTTCCCCTT 0: 2
1: 6
2: 35
3: 530
4: 3647
Right 1118533915 14:66737248-66737270 CCTTCCCTTTCCCCTCTTTCGGG 0: 1
1: 0
2: 4
3: 39
4: 601
1118533909_1118533921 11 Left 1118533909 14:66737229-66737251 CCTTCCTCTTTCTTTTTCCCCTT 0: 2
1: 6
2: 35
3: 530
4: 3647
Right 1118533921 14:66737263-66737285 CTTTCGGGCTTTTGAGTGAATGG 0: 1
1: 0
2: 0
3: 8
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118533909 Original CRISPR AAGGGGAAAAAGAAAGAGGA AGG (reversed) Intronic
Too many off-targets to display for this crispr