ID: 1118535193

View in Genome Browser
Species Human (GRCh38)
Location 14:66756056-66756078
Sequence TCTCCTTTACCTCTAACCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 371
Summary {0: 1, 1: 0, 2: 3, 3: 35, 4: 332}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118535192_1118535193 26 Left 1118535192 14:66756007-66756029 CCTCTCTTTATTATAAGTTGTAT 0: 1
1: 0
2: 0
3: 20
4: 328
Right 1118535193 14:66756056-66756078 TCTCCTTTACCTCTAACCCCAGG 0: 1
1: 0
2: 3
3: 35
4: 332

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118535193 Original CRISPR TCTCCTTTACCTCTAACCCC AGG Intronic
900490611 1:2947092-2947114 TCCCCTGGACCTCTCACCCCTGG + Intergenic
901695893 1:11007968-11007990 TCTCCAGTACCTGTAACCACAGG + Intergenic
902435543 1:16396093-16396115 TCTCCGTCACTTCTAAGCCCAGG - Exonic
902464356 1:16606766-16606788 TGCCATTTACCTCTAACCCTGGG + Intronic
903313685 1:22482648-22482670 CCTCCCTCTCCTCTAACCCCTGG + Intronic
903649385 1:24913729-24913751 GCTCCTTTACCACTGTCCCCAGG + Intronic
903800457 1:25963460-25963482 TCTCCCTTCACTCCAACCCCTGG - Intronic
904088896 1:27930722-27930744 TCTGCTGCACCTCTGACCCCAGG + Intergenic
905408288 1:37752373-37752395 TGTCCCTTACCTCCAACCCTCGG - Intronic
906394920 1:45454242-45454264 TCTCCATTCCCCCCAACCCCTGG - Intronic
907549672 1:55293685-55293707 TCTTATTTATCTCTAGCCCCAGG - Intergenic
911660716 1:100498611-100498633 TTTCCTTTACTTCCCACCCCAGG + Intronic
911714803 1:101119608-101119630 TCTCCCTGACCTCGAATCCCTGG + Intergenic
913396859 1:118381165-118381187 TCTCATTTTTCACTAACCCCAGG - Intergenic
913601137 1:120421922-120421944 TGCCATTTACCTCTAACCCTGGG - Intergenic
913959848 1:143330448-143330470 TTTCCCTTGCCTCCAACCCCTGG - Intergenic
913993096 1:143633747-143633769 TGCCATTTACCTCTAACCCTGGG + Intergenic
914054207 1:144156021-144156043 TTTCCCTTGCCTCCAACCCCTGG - Intergenic
914085907 1:144454679-144454701 TGCCATTTACCTCTAACCCTGGG + Intronic
914124939 1:144810340-144810362 TTTCCCTTGCCTCCAACCCCTGG + Intergenic
914191804 1:145418659-145418681 TGCCATTTACCTCTAACCCTGGG + Intergenic
914362326 1:146945478-146945500 TGCCATTTACCTCTAACCCTGGG - Intronic
914489348 1:148141605-148141627 TGCCATTTACCTCTAACCCTGGG + Intronic
914589729 1:149096660-149096682 TGCCATTTACCTCTAACCCTGGG + Intronic
915136623 1:153736409-153736431 TCTCCTTTACCATTATCCTCAGG - Intronic
915957951 1:160238909-160238931 TCTCCCTTTCCTTTAACTCCTGG - Intronic
916374716 1:164140163-164140185 CCTGCCTTCCCTCTAACCCCTGG - Intergenic
917152754 1:171962376-171962398 TCTGCCTTTCCTCCAACCCCTGG - Intronic
917152845 1:171963360-171963382 TCTCCCTCTCCCCTAACCCCAGG - Intronic
920761483 1:208787313-208787335 TGTCCCTTAACTCCAACCCCTGG + Intergenic
921426666 1:215010645-215010667 TCACCTTGACCTCTTACCTCGGG - Intronic
921802638 1:219418806-219418828 TCTCCATCTCCTCTCACCCCTGG + Intergenic
922327169 1:224538732-224538754 TCACCATAACCTCTAACTCCTGG + Intronic
922637442 1:227188681-227188703 CCTCCCTTCCCGCTAACCCCTGG - Intronic
922641740 1:227239250-227239272 TCTCCCTCACCACTGACCCCTGG - Intronic
923753124 1:236765336-236765358 TTTCCTTTGCCTCTAATCCACGG - Intergenic
1063613907 10:7586024-7586046 TCTCCATGACCTCCGACCCCAGG - Exonic
1064606916 10:17051482-17051504 TCTCTTTTAAATCTAACACCTGG - Intronic
1064707355 10:18086624-18086646 TCTCTGTAACCTCTAACTCCTGG - Intergenic
1065507527 10:26444206-26444228 GCTCATTTACCTCTAACTACAGG - Intronic
1065536706 10:26722028-26722050 TTTCCTTTAACTCCCACCCCTGG + Intronic
1065662186 10:28017221-28017243 TCACTCTAACCTCTAACCCCTGG - Intergenic
1067680122 10:48429399-48429421 TATCCTTTACTCCTAGCCCCAGG + Intronic
1067988409 10:51180319-51180341 TCTTTTTTACTTCTAACCTCAGG + Intronic
1068928446 10:62564183-62564205 TGTCCTTCACCTCTGACCACGGG + Intronic
1070199472 10:74189755-74189777 TCTCCCTAACCTCTAACCCCTGG + Intronic
1070243231 10:74704168-74704190 TCCTCTTTACTTCTAGCCCCTGG - Intronic
1070344345 10:75527033-75527055 TCTCCCCTCCCTCTAACTCCTGG + Intronic
1070716949 10:78729330-78729352 CCTCCTTTGCATCTAAACCCAGG - Intergenic
1071017043 10:81009782-81009804 TCTCTTTTCCCTCTAACACATGG - Intergenic
1071361215 10:84847832-84847854 TCTCCTTGACTTCTGAGCCCAGG + Intergenic
1072533574 10:96342305-96342327 TCTCCTTCTCCTCTAACTTCAGG + Intergenic
1073164534 10:101433397-101433419 TCTTCTTTACCTCAAACTTCAGG - Intronic
1073292088 10:102418503-102418525 TCTCCTCTCCCTCTCTCCCCAGG + Intronic
1073619128 10:105028798-105028820 TCTCTTTGACCTCTAACACCAGG - Intronic
1073851801 10:107629074-107629096 ACCCCTTTACCTCTAACCTCAGG - Intergenic
1074813953 10:117131035-117131057 TCTCCCTTCCTTCTCACCCCTGG + Intronic
1075221069 10:120585138-120585160 TTTGTTTTTCCTCTAACCCCAGG - Intronic
1075696999 10:124443832-124443854 CATCCTTTACCTGTAGCCCCTGG - Intergenic
1076831364 10:132996075-132996097 TGTCCCTCACCTCTGACCCCTGG + Intergenic
1077020571 11:415508-415530 TGTCTTTGACCTCTGACCCCGGG + Intronic
1077749155 11:4944586-4944608 TCTCCTACACTTCTAACCTCAGG - Intronic
1080842544 11:35998117-35998139 TTTCCTTTTTCTCTAACCCTGGG + Intronic
1081014196 11:37855820-37855842 TCTCCTTTACCACTGACTCCTGG + Intergenic
1081410948 11:42757755-42757777 TCTCCTGTCCCTCTGAACCCAGG + Intergenic
1081525514 11:43925048-43925070 CCTCCTTTCCCTCTCACTCCAGG - Intergenic
1084644284 11:70445659-70445681 TCTCCCTGACCTCTAAATCCTGG - Intergenic
1084901640 11:72314377-72314399 ACTCCTTGACCTTTGACCCCTGG - Intronic
1085132557 11:74053918-74053940 ACTCCTCTATCTCTAACTCCTGG - Intronic
1085677173 11:78533807-78533829 CCTCCCTTTCCCCTAACCCCTGG + Intronic
1088087147 11:105994947-105994969 TCTCCATAACCTCTTAACCCAGG - Intergenic
1088594707 11:111432134-111432156 TCTCCTTTCTCTCTAGCTCCAGG - Intronic
1088675165 11:112185924-112185946 TCTTCCCTTCCTCTAACCCCTGG + Intronic
1089313092 11:117572902-117572924 TCTCCTCTCCCTCTGCCCCCGGG - Intronic
1091101873 11:132881995-132882017 TCTCCTTAGCCCCTAACCACAGG - Intronic
1091544607 12:1493126-1493148 TTTCATATACCTCTAACCCCCGG + Exonic
1091781846 12:3218858-3218880 TCTCTTTTTCCTTTACCCCCCGG + Intronic
1092585494 12:9897287-9897309 TTCCCTTTCCCTCTACCCCCTGG + Intergenic
1092660800 12:10735869-10735891 TCTCCTTTCCCCCTGACCCTTGG - Intergenic
1094144544 12:27214689-27214711 TCTCATTCACTTCTGACCCCAGG - Intergenic
1094444101 12:30510739-30510761 TCTCCCCTACCTCCACCCCCTGG + Intergenic
1094598937 12:31891472-31891494 TCTTATTTTCCTCTGACCCCTGG - Intergenic
1095138192 12:38632217-38632239 TCTCCTATACCTCATACCTCAGG - Intergenic
1096133645 12:49181227-49181249 TCACCGTAACCTCTAACTCCAGG - Intergenic
1096720359 12:53516806-53516828 TCTCTTTTAACACTAACCCTTGG - Exonic
1097289232 12:57900024-57900046 TCACCATAACCTCTAACTCCTGG + Intergenic
1097627276 12:62015877-62015899 TCTCCTATCCCTCTAGCCCCTGG - Intronic
1098072813 12:66694399-66694421 TATCCTTTACCTCTTCCCCAAGG + Intronic
1098593408 12:72241309-72241331 TCCCCTTTATCCCTAACTCCTGG + Intronic
1099656215 12:85495289-85495311 TCTCCATGACCTCTGACTCCAGG - Intergenic
1101649459 12:106661723-106661745 TCTCCCTGTCCCCTAACCCCTGG + Intronic
1102039168 12:109789564-109789586 TCTCCTTTCCTACTAAGCCCAGG + Intronic
1102758078 12:115360133-115360155 TTTCCTTTCCCACTAACCCCTGG + Intergenic
1103080237 12:118017979-118018001 TCTCCCCTTCCTCTAGCCCCTGG + Intronic
1103848100 12:123913612-123913634 TCTTGGTGACCTCTAACCCCTGG + Intronic
1104550882 12:129756112-129756134 TTTCCACTACCTCTATCCCCTGG - Intronic
1105341575 13:19531011-19531033 TCTCCCCTACCCCTATCCCCTGG + Intronic
1105726919 13:23172064-23172086 TCTCCACTACCTCTTACTCCTGG + Intergenic
1105826103 13:24125093-24125115 TTTCCTTTCTCTCCAACCCCTGG + Intronic
1106667739 13:31870352-31870374 GCTCCTTTACTCCTAACCCGGGG - Intergenic
1106939284 13:34759379-34759401 CCTCCCTCCCCTCTAACCCCTGG + Intergenic
1107260521 13:38484994-38485016 TCCCCCTTACCCCAAACCCCCGG - Intergenic
1108243198 13:48488380-48488402 CCTCCTTTGCCCCTAACTCCTGG - Intergenic
1110458627 13:75718800-75718822 CCTCCCTTACCTCTAATCCCTGG + Intronic
1110826936 13:79981827-79981849 CCTCCTTTCCCACTAACCCCTGG + Intergenic
1112403835 13:99100323-99100345 TCTCCTCTCCCTCCAGCCCCTGG - Intergenic
1112414382 13:99192138-99192160 TCTCCTTATCCTCTTACCCCTGG - Intergenic
1113255615 13:108501368-108501390 TCTCCTCTGCCGGTAACCCCGGG + Intergenic
1113367440 13:109689639-109689661 TCTCCTTTGTGTCTAAGCCCTGG - Intergenic
1113434091 13:110275891-110275913 ACCCCCTTACCTCTGACCCCTGG - Intronic
1113503295 13:110794898-110794920 TCTTCCCTCCCTCTAACCCCAGG + Intergenic
1114619177 14:24084745-24084767 TCTCCATTTCCCCCAACCCCAGG - Intronic
1114625990 14:24130801-24130823 TCTCCTCTACCTCTGTCACCTGG + Intronic
1115892490 14:38046948-38046970 TCTCCTTTACATTTCAGCCCAGG + Intergenic
1117466791 14:56001763-56001785 TTTCCTTGACCTCTCACCCCAGG + Intergenic
1118535193 14:66756056-66756078 TCTCCTTTACCTCTAACCCCAGG + Intronic
1118753105 14:68820696-68820718 TCTCCTTTCCCTCCTCCCCCAGG + Intergenic
1119153969 14:72391522-72391544 ATTCCTTTACTTCTCACCCCTGG + Intronic
1119629989 14:76221804-76221826 TCTCCTTCCCATCTAACCCTTGG - Intronic
1121420615 14:93810864-93810886 GCTCCCTTGCCTTTAACCCCAGG - Intergenic
1124021917 15:25933151-25933173 TCTCCTTCAACTCTCACCCTTGG + Intergenic
1124168830 15:27353952-27353974 TCTCCTGCACCTCCAGCCCCTGG + Intronic
1126464186 15:48945700-48945722 TCTTCTTCCCCTCCAACCCCTGG - Intronic
1126554701 15:49972884-49972906 CCACATTTTCCTCTAACCCCTGG - Intronic
1127184022 15:56459116-56459138 TCACCTTTTCCCCCAACCCCTGG + Intronic
1128188516 15:65666702-65666724 TCACTGTGACCTCTAACCCCTGG - Intronic
1129518009 15:76168697-76168719 TCTCTTTTATCCCTAACACCTGG - Intronic
1130612730 15:85376304-85376326 TCTTCTTCACCTATAACCCCAGG + Intergenic
1131432806 15:92400298-92400320 TATCCTTTATCTCCAGCCCCTGG + Intronic
1131659733 15:94501021-94501043 TCTCCCTACCCTCTAGCCCCTGG + Intergenic
1132608860 16:805232-805254 CCGCCTGTACCTCTAACCACAGG + Intergenic
1133844238 16:9439301-9439323 TCTCCATTACCAAGAACCCCAGG + Intergenic
1133897598 16:9944288-9944310 TTTACTTTTCCTCTCACCCCTGG - Intronic
1134251924 16:12580318-12580340 TCTACCTTTCCTCCAACCCCTGG - Intergenic
1135049547 16:19181446-19181468 TTTCTTTTCCCTCTATCCCCAGG - Intronic
1135430113 16:22375175-22375197 TCTCCTTGACATCTGAGCCCTGG + Intronic
1135662198 16:24306531-24306553 ACTTCTTTGCCTCTAACACCAGG + Intronic
1139027375 16:62834817-62834839 TCTCCTTTCCCTTTTAGCCCTGG - Intergenic
1140093804 16:71858371-71858393 TCACCATAACCTCTAACTCCTGG - Intronic
1141971478 16:87486958-87486980 TCTCCTTTAGCCCTAAACTCTGG - Intronic
1143071053 17:4293791-4293813 TCTCCTTTACCATTCACCTCTGG + Intronic
1143138057 17:4723141-4723163 GCTCCTTGACCTCTAAGCCCAGG + Intergenic
1143251858 17:5528807-5528829 TCTCATTTACCTCTATTCCTGGG + Intronic
1143617978 17:8064741-8064763 TCTGCTTTGCCTCTTCCCCCAGG - Intergenic
1144871560 17:18375267-18375289 TCTCCTCTACTTCACACCCCAGG + Intergenic
1147171305 17:38620697-38620719 TCTCCTTCACCCCCAACCTCAGG + Intergenic
1147344508 17:39780127-39780149 TCACCGTAACCTCAAACCCCTGG - Intronic
1147393513 17:40123466-40123488 CCTCCTTTACCCCTAACCCGGGG - Intronic
1147442149 17:40453848-40453870 TCTCACTTAGCTCTGACCCCAGG + Intronic
1148149815 17:45389878-45389900 TCTTCATTCCCTCCAACCCCTGG - Intergenic
1148835926 17:50465739-50465761 TCGCCCTTACCAATAACCCCTGG - Exonic
1149186200 17:54000713-54000735 TCTCCATTACCTCCAAACCAAGG - Intergenic
1150435157 17:65148074-65148096 TTTCCCTTCTCTCTAACCCCTGG + Intronic
1150701772 17:67453339-67453361 TCTCCATTACCTCTCACCAAGGG - Intronic
1151799499 17:76369596-76369618 TCACCGTAACCTCTAACTCCTGG - Intronic
1153233851 18:2967229-2967251 TCTCCACTACCTCTGACCCATGG + Intronic
1153640416 18:7152049-7152071 TCTTCCTTCCCTCTAGCCCCTGG - Intergenic
1154163653 18:11998090-11998112 TCACAGTAACCTCTAACCCCAGG - Intronic
1155083862 18:22436443-22436465 TCTCCTTTTCATCTATCCCAGGG + Intergenic
1156747077 18:40405322-40405344 TCTCCCTTTCCCCTAAACCCTGG + Intergenic
1157552795 18:48593058-48593080 TCTCCTGTTCCTCTCACCCTGGG + Intronic
1157682318 18:49616638-49616660 TGTCCTTCACCTCCAACCCCAGG - Intergenic
1158654485 18:59318162-59318184 TGCCGTTTACCTCTAACCCAAGG - Intronic
1160098386 18:75897449-75897471 TTTCCTTTACCCTTACCCCCAGG + Intergenic
1161381927 19:3970183-3970205 TCTCCTCAACCTCAAATCCCAGG + Intronic
1161550624 19:4910228-4910250 TCACCTCGACCTCCAACCCCCGG - Intronic
1162126885 19:8504260-8504282 TCTCTACTACCTCTAACCTCTGG - Intergenic
1162770079 19:12944130-12944152 TCTCCTTCAGCCCTCACCCCTGG + Exonic
1163161323 19:15466027-15466049 TCTCTGTAACCTCTAACTCCTGG + Intergenic
1163210650 19:15837182-15837204 TCTCCTGTCTTTCTAACCCCAGG - Intergenic
1164275846 19:23717392-23717414 TCTCCTCCACCCCTAACCACAGG + Intergenic
1167665824 19:50822382-50822404 TCTTCTTTACCTCTCAGACCTGG - Intronic
1168288487 19:55346026-55346048 TGTCCTTTGCCTGTAGCCCCTGG - Intronic
1168501026 19:56893438-56893460 TCTCCTTTACCCATAGCCCCTGG - Intergenic
1202693686 1_KI270712v1_random:108700-108722 TTTCCCTTGCCTCCAACCCCTGG - Intergenic
926291546 2:11535099-11535121 GCTCCTCTACCTCCCACCCCAGG - Intronic
926756871 2:16243538-16243560 TCTCCTCTGACTCTAAGCCCAGG - Intergenic
927523149 2:23713572-23713594 TCTCCCCAACCCCTAACCCCGGG + Intergenic
927584410 2:24287363-24287385 TTTCCCCTCCCTCTAACCCCTGG + Intronic
928659132 2:33482795-33482817 TTTCCCCTACCTCTAAGCCCTGG - Intronic
931053249 2:58437940-58437962 TTTCCTTTACATCTAAATCCAGG - Intergenic
931239774 2:60441698-60441720 TAGCCTTTACCTTTAACTCCAGG + Intergenic
931522315 2:63112275-63112297 CCTCCTTTTCCTGTAACCCCTGG + Intergenic
933359659 2:81264821-81264843 TCTCCCTCTCCCCTAACCCCTGG + Intergenic
933934285 2:87188493-87188515 TCTTCTTGCCCTCTACCCCCTGG + Intergenic
934981123 2:98842568-98842590 TCCCCGCTACCTTTAACCCCTGG + Intronic
936358857 2:111777402-111777424 TCTTCTTGCCCTCTACCCCCTGG - Intronic
936554915 2:113487534-113487556 TTTCGTCTCCCTCTAACCCCTGG + Intronic
939380017 2:141423142-141423164 TCTCCCTAACCTCTACCTCCTGG + Intronic
939560196 2:143722800-143722822 TCTCCTTTGCCTCTGGCCACAGG - Intronic
939610043 2:144298923-144298945 CCTCCTTAGCTTCTAACCCCTGG + Intronic
939724871 2:145705575-145705597 TCCCATTTACCTCACACCCCAGG + Intergenic
941129566 2:161629707-161629729 CCTCCCTTTCCACTAACCCCTGG + Intronic
941499552 2:166253778-166253800 ACTGCTTTACCTCAAAACCCAGG - Intronic
942148697 2:173053134-173053156 TCTCCTCTCCCTCCAACCTCTGG + Intergenic
942366881 2:175237640-175237662 CCTCCTATCCCTCTTACCCCTGG + Intergenic
942721492 2:178958119-178958141 GCTCCCTTCCCTCTAAACCCTGG - Intronic
944085181 2:195837675-195837697 TCTCCTTTATCTCTACCCCAAGG + Intronic
944373497 2:199012424-199012446 ATTCCTTTACCTCCAACCACAGG - Intergenic
944517704 2:200528777-200528799 TCTCCCTAACCTCTTACCACTGG - Intronic
945905691 2:215590203-215590225 TCTCCTTTGCCTCTGACTCACGG - Intergenic
946444905 2:219730020-219730042 TCTCTTCTACCTCCAACCCCTGG + Intergenic
946720495 2:222601105-222601127 TTCCCTTTCCCTCCAACCCCTGG - Intronic
946776150 2:223143197-223143219 TCTCCTTTACCTGTAGCCCATGG + Intronic
946819616 2:223616492-223616514 TCTCCTTTATAGCTAGCCCCAGG - Intergenic
1169330242 20:4710545-4710567 TCTCCTTTTACCCCAACCCCTGG + Intergenic
1170113547 20:12831600-12831622 TCTCCTTTTCCTGTATCCACTGG + Intergenic
1170653470 20:18264310-18264332 TCTCCCCTCCCTCTAGCCCCTGG + Intergenic
1170674496 20:18466912-18466934 CCTCCTCTTCCTCTAACCGCGGG + Intronic
1172034290 20:32000652-32000674 CCTCAGTTACCTCTAACCCCAGG + Exonic
1172133445 20:32671762-32671784 TCACCTTAACCTCCAACTCCTGG - Intergenic
1172530313 20:35626464-35626486 TCACCTTTTCCTCTAAGCCTGGG - Intronic
1172693111 20:36804007-36804029 TCCCCCAAACCTCTAACCCCTGG - Intronic
1173595767 20:44257730-44257752 TGTCCTTGCCCTGTAACCCCTGG - Intronic
1173961968 20:47080940-47080962 TCTCCGTAACCTCGAACTCCTGG + Intronic
1174211842 20:48885893-48885915 TCTCCCTTTTCTCTAACCCCTGG - Intergenic
1174449876 20:50613016-50613038 TCTCCGTAACCTCAAACTCCTGG - Intronic
1174913852 20:54634931-54634953 CCTCCTTTAGCTATCACCCCTGG + Intronic
1175141374 20:56862692-56862714 CCTCCCTGACCTCTACCCCCTGG + Intergenic
1176965348 21:15206338-15206360 CCTCCCTTACCTCTCATCCCAGG - Intergenic
1177351649 21:19951105-19951127 TCTGCTCTACCACTAGCCCCAGG + Intergenic
1179732301 21:43374627-43374649 TCTCCTTTACCCCTTGCCCCAGG - Intergenic
1181092018 22:20480183-20480205 TCTCCTTTACCCCCAGGCCCTGG - Intronic
1182170335 22:28222269-28222291 TCTGCTTTACCTCTCACATCTGG - Intronic
1183395894 22:37570572-37570594 TCACCTTGACCTCTGACCCTGGG + Exonic
1184361606 22:44022466-44022488 TCTCCTTGACCACAAACTCCTGG + Intronic
949142317 3:649602-649624 TCTCCTTTTCCCCAAAGCCCAGG - Intergenic
949546351 3:5075924-5075946 CCTCCCTTCCCTCAAACCCCTGG - Intergenic
949624171 3:5849031-5849053 TCTCCTTGTCCCATAACCCCTGG - Intergenic
950547941 3:13649846-13649868 GCTCCCTTCCCCCTAACCCCTGG - Intergenic
951537666 3:23754391-23754413 TCTCCTTTCCCTTCAGCCCCTGG + Intergenic
952015930 3:28957930-28957952 TCTCCATTCCCCCAAACCCCTGG + Intergenic
953267027 3:41400361-41400383 TCTCCTCCATCCCTAACCCCTGG + Intronic
953384361 3:42498057-42498079 TCCCCTCTTCCTCTATCCCCTGG + Intronic
953577445 3:44124306-44124328 TCTCCCTTTCTTCTAACCCCTGG + Intergenic
953577459 3:44124467-44124489 TCTCCCTTTCTCCTAACCCCTGG + Intergenic
956381921 3:68673377-68673399 CCTCATTTGCCTCTGACCCCAGG + Intergenic
956861729 3:73330938-73330960 TCTGCCCTCCCTCTAACCCCTGG - Intergenic
959063713 3:101637238-101637260 TTTCCTTTATCTCATACCCCAGG - Intergenic
959768091 3:110058125-110058147 TCTCCAATCCCTCTAACTCCAGG - Intergenic
961053301 3:123765902-123765924 CTTCCTTTCCCTCTAGCCCCTGG - Intronic
961519798 3:127460473-127460495 TCTCCTTTTCCTCCAGCTCCTGG + Intergenic
961813500 3:129535296-129535318 CCTCCTCCACCTCTAGCCCCAGG - Intergenic
963015096 3:140816492-140816514 TCTCCCCTACTTCTGACCCCTGG - Intergenic
963610995 3:147468193-147468215 TCTCTGTAACCTCGAACCCCTGG + Intronic
963784048 3:149515161-149515183 TCTCCTTTACCTGAAATGCCTGG + Intergenic
966300744 3:178476861-178476883 TCTCCTTCTCCTCTAGCCCTTGG - Intronic
966947329 3:184786147-184786169 TCTCCTTTACTTCAAATTCCAGG + Intergenic
967453789 3:189657167-189657189 TTCCCTTTACCCCAAACCCCTGG - Intronic
968280888 3:197476002-197476024 TTCCCTTTACCTCAGACCCCTGG + Intergenic
970095665 4:12460562-12460584 TCTCCTTTACCTTGACCTCCTGG + Intergenic
970352117 4:15212306-15212328 TTTCCTTCACCTTTAACCCCTGG - Intergenic
970472444 4:16392456-16392478 TTTCCTTCACCTCTAACAGCTGG + Intergenic
971614962 4:28776984-28777006 TTTCCTTTCCCTCCAACCCCTGG - Intergenic
972159678 4:36208174-36208196 TCTCCTTTGCATTTAAGCCCTGG - Intronic
973837224 4:54822220-54822242 TCTTCTTCCCCTCTAACTCCTGG + Intergenic
974071753 4:57130358-57130380 TTTCCTTCCCCACTAACCCCTGG + Intergenic
974176110 4:58327150-58327172 GTTCCTTTAGCACTAACCCCAGG - Intergenic
974268074 4:59611756-59611778 TCTCATTTACATCTAATACCTGG + Intergenic
975604353 4:76138734-76138756 TGGCCTTTACCTCTACCCCATGG - Intronic
975836145 4:78423837-78423859 TTTTCTTTCCCTCTAATCCCAGG - Intronic
975931737 4:79532637-79532659 TCTCCTCTATCTCTAAAGCCAGG - Intergenic
976285601 4:83367945-83367967 TCTTCTTTCCCTCTAACCTGGGG - Intergenic
976425697 4:84900666-84900688 TCTCTCTCACCTCTAACCCCTGG - Intronic
977718623 4:100212338-100212360 TCTTCTTTCCTTCTATCCCCAGG + Intergenic
981424263 4:144585148-144585170 TCTTCTTTTCCTCTGGCCCCTGG + Intergenic
982007504 4:151077476-151077498 TCTCCTTCATCTCTAGCCTCAGG + Intergenic
982140072 4:152308898-152308920 TCTTCTATACCTATAGCCCCAGG + Intergenic
982981086 4:162136314-162136336 TCTCCTTTTCCTCTAATAACCGG - Intronic
985198803 4:187462614-187462636 TCTCCATCACCTCTACACCCAGG - Intergenic
985265108 4:188149875-188149897 TCACCGAAACCTCTAACCCCTGG + Intergenic
985485062 5:143901-143923 ACTTCTTTAGCTCTAACTCCAGG - Intronic
986131378 5:4935107-4935129 TCACTGTTACCTCGAACCCCTGG + Intergenic
988300320 5:29416734-29416756 TCTCCTTTACCCCCAGACCCTGG - Intergenic
988694162 5:33602994-33603016 TCTCCTTTTCCTTTATCTCCTGG - Intronic
992954811 5:81896638-81896660 TCTCCTCTTCCTCCAACCCTAGG + Intergenic
995886158 5:116896190-116896212 TCTCCTTCTTCTCTAACCCCTGG + Intergenic
996363367 5:122675038-122675060 TCCCCTTTCCCTCCAGCCCCTGG + Intergenic
996470327 5:123852755-123852777 TCACCTATATCTCTAAGCCCAGG - Intergenic
996631279 5:125635911-125635933 TCTCCCTTTCCTCAAACCCCTGG - Intergenic
997358787 5:133281191-133281213 TCTCCTTTAGCTCAAATCCTGGG + Intronic
997629083 5:135353106-135353128 TGTCCTTTACCTGTATCCCAAGG - Intronic
1001306741 5:170580168-170580190 TCCCCTTTACCTCTACCCACTGG - Intronic
1005049125 6:21667165-21667187 TCTCCTTGACCGCTAACACAAGG - Intergenic
1005559793 6:27026882-27026904 TCAATTTTACCTCCAACCCCAGG + Intergenic
1005728789 6:28675663-28675685 TCACCTTTACCCCTAACCCCTGG - Intergenic
1006353156 6:33536225-33536247 TCACCTTAACCTCCAACTCCTGG + Intergenic
1006390676 6:33756436-33756458 TCTTCTCTACCTCTCTCCCCTGG - Intergenic
1006635394 6:35457912-35457934 CCTCCAATCCCTCTAACCCCTGG - Exonic
1009754155 6:67913708-67913730 TCCCCATTTCCTCTATCCCCAGG + Intergenic
1010126201 6:72434981-72435003 TCTCCTTCACCTCTTACCCCAGG - Intergenic
1012399740 6:98833898-98833920 TCTCCTTCCCCTCTACCCCGCGG - Intergenic
1012548908 6:100450071-100450093 TCTCCTTTACCTTCCACCCTAGG - Intronic
1013274743 6:108573358-108573380 CATTCTTTACCTCTATCCCCAGG + Intronic
1013937725 6:115618233-115618255 TCTCCTTCACCTCCACCCCTAGG - Intergenic
1014044747 6:116872540-116872562 TTTCCCCTACTTCTAACCCCTGG + Intergenic
1014219981 6:118790147-118790169 TCTCCTTTCTCTCTATACCCAGG - Intergenic
1014527209 6:122514850-122514872 TTCCCTTTTCCTCTCACCCCTGG - Intronic
1014756549 6:125307831-125307853 TCTTCTTTACTTCTAACCAAAGG + Intergenic
1016406409 6:143736101-143736123 TCACCTTAACCTCTAACTCCTGG + Intronic
1017031068 6:150222610-150222632 TCTCCTTCCCCACTCACCCCTGG + Intronic
1017383214 6:153854606-153854628 TCACTTTTATCTCTAACTCCTGG - Intergenic
1017425519 6:154316609-154316631 TCTCCTCTTCCCCTAACCCTTGG - Intronic
1019714268 7:2531095-2531117 CCTGCTTTCCCTCTGACCCCAGG - Intergenic
1019846908 7:3512119-3512141 TATCTCTTCCCTCTAACCCCTGG + Intronic
1020498222 7:8883645-8883667 TCCTCCTTACCTCCAACCCCCGG - Intergenic
1020566617 7:9805500-9805522 TCTCCTTCTCCCCTAACCCCAGG - Intergenic
1020822735 7:12990306-12990328 TATCCTTTTCCTCTTACCTCTGG - Intergenic
1021429598 7:20545396-20545418 GCTCCTTTTCCTCTAATCCATGG - Intergenic
1023540408 7:41258736-41258758 TCTCCCTCCCCACTAACCCCTGG + Intergenic
1024507870 7:50178116-50178138 CCGCCTTTCCCTCTAAACCCTGG - Intergenic
1026252418 7:68682518-68682540 TCACCGTTACCTCCATCCCCTGG + Intergenic
1027725643 7:81802178-81802200 TCCTCCTTACCCCTAACCCCAGG - Intergenic
1027861828 7:83593755-83593777 TCTCTTTTATCTCTAGACCCGGG - Intronic
1028259422 7:88642694-88642716 TCTCCTTTAGCTATCACCACTGG + Intergenic
1032143697 7:129358577-129358599 TCTCCCTTCCCTCCAGCCCCTGG - Intronic
1033219286 7:139517484-139517506 TCTCCATTTCCCCTCACCCCCGG - Intergenic
1033836282 7:145316125-145316147 TCCCCTTGACCGCAAACCCCCGG + Intergenic
1036980454 8:13464230-13464252 TCTCAATTACCTCTGACCCTGGG - Intronic
1038702201 8:29859302-29859324 TCTCTTTTTCATTTAACCCCTGG + Intergenic
1038738474 8:30194481-30194503 TCTCCCTTCCTCCTAACCCCTGG + Intergenic
1040363334 8:46688708-46688730 TCACCTCAACCTCTAACTCCTGG + Intergenic
1040592459 8:48806046-48806068 CCTCCCTTCCCCCTAACCCCTGG + Intergenic
1041225289 8:55691643-55691665 TCTCCCCTTCCTCTAACCCTGGG - Intergenic
1042181380 8:66091151-66091173 TCTTCATTTCCTCTAGCCCCTGG - Intronic
1042357998 8:67850588-67850610 TCCCCTTTCCCCCTAGCCCCTGG + Intergenic
1042368429 8:67963213-67963235 TCTCCTTTCCCTCTTCTCCCTGG + Intronic
1043433051 8:80213019-80213041 TCTCTCTTACCTCTCACCTCTGG + Intronic
1044399309 8:91751865-91751887 ATTCCTCTACCTCTAACTCCTGG - Intergenic
1045455275 8:102371990-102372012 TCACTTTTACCTCAAACTCCTGG - Intronic
1045520928 8:102902523-102902545 TCTCCTTTCCCTCTGGTCCCGGG - Intronic
1045629642 8:104103215-104103237 TCTCCTTTCCCCTTAACCCCTGG - Intronic
1046140490 8:110083969-110083991 TCTCCTCTACCTCTCATCACAGG - Intergenic
1047629820 8:126694689-126694711 TCTCCTTCTCCCCTAACCCCTGG + Intergenic
1047663680 8:127066273-127066295 TCTCCCTTCCTTCTAACCCCTGG - Intergenic
1048892815 8:138963119-138963141 TCCCCTTTACCCCTAGCCTCTGG + Intergenic
1049313551 8:141946886-141946908 TCTCCTTTGACTCCAATCCCAGG + Intergenic
1050492339 9:6201300-6201322 TTTCCCTTACCTCTAGCCCCTGG - Intergenic
1052079853 9:24191106-24191128 TCTCCCTGTCCTCTAACTCCTGG + Intergenic
1052769124 9:32671430-32671452 TCTCCTTTCACTGTAATCCCTGG - Intergenic
1053571046 9:39307541-39307563 TCCCCTTTCCCTCAAACTCCTGG - Intergenic
1053836931 9:42148149-42148171 TCCCCTTTCCCTCAAACTCCTGG - Intergenic
1054092606 9:60866243-60866265 TCCCCTTTCCCTCAAACTCCTGG - Intergenic
1054126099 9:61311471-61311493 TCCCCTTTCCCTCAAACTCCTGG + Intergenic
1054346378 9:63969436-63969458 TTTCGTCTCCCTCTAACCCCTGG - Intergenic
1054444154 9:65296086-65296108 TTTCGTCTCCCTCTAACCCCTGG - Intergenic
1054593675 9:67040355-67040377 TCCCCTTTCCCTCAAACTCCTGG + Intergenic
1055257683 9:74391359-74391381 TATCCCTTCCCTCTGACCCCTGG - Intergenic
1055526985 9:77144861-77144883 TCTCCCTTTCCCCTAACCTCTGG - Intergenic
1056104261 9:83331432-83331454 CCTCCTTCTCCCCTAACCCCTGG - Intronic
1060055729 9:120411341-120411363 ACTCCTTTAACTCTTACCTCTGG + Exonic
1060688995 9:125639369-125639391 TCTCCTTCACCTCTCACTGCGGG + Intronic
1061495127 9:130969318-130969340 CCTCCTTTCCCTCCAGCCCCTGG - Intergenic
1061797036 9:133091774-133091796 TTTCCCCTCCCTCTAACCCCTGG + Intergenic
1061872937 9:133530270-133530292 TCTCCTTTCCCTGCAAGCCCAGG - Intergenic
1185614256 X:1411107-1411129 TCTCCGTAACCTCCACCCCCAGG - Intronic
1185652790 X:1661079-1661101 TCTCCTCTACCTTTAGCCCTGGG - Intergenic
1189189132 X:39082269-39082291 TTGCCCCTACCTCTAACCCCTGG - Intergenic
1189892162 X:45614476-45614498 TTCCCTTAACCCCTAACCCCTGG - Intergenic
1190891947 X:54577060-54577082 TCTCCTTTCCCTCCAGTCCCTGG + Intergenic
1192163430 X:68806693-68806715 TCCCCTCTCCCTCCAACCCCTGG - Intergenic
1193137276 X:77985823-77985845 TTTTCCCTACCTCTAACCCCTGG + Intronic
1194390514 X:93312163-93312185 TCTCCAGTTCCTCTATCCCCAGG - Intergenic
1195010128 X:100725240-100725262 TCTCCTTTCTCTCTTAGCCCTGG - Intronic
1195131074 X:101852816-101852838 TCTCCATAACCTCAAACTCCTGG - Intronic
1195998273 X:110753384-110753406 TCCCCTTTTCCCCTAGCCCCTGG - Intronic
1196155578 X:112425089-112425111 CCTCCCTTTCCTCTAGCCCCTGG + Intergenic
1196805123 X:119576726-119576748 TCCTCTTTACCTTTACCCCCTGG + Intronic
1198637706 X:138717688-138717710 TCTCTGTAACCTCTAACTCCTGG + Intronic
1199204406 X:145131503-145131525 CCTCCTTTTGCTCTAACCCTAGG - Intergenic
1200143528 X:153913741-153913763 CCTCGTCTCCCTCTAACCCCCGG + Intronic