ID: 1118535593

View in Genome Browser
Species Human (GRCh38)
Location 14:66760113-66760135
Sequence CATTTACTACCCATTTCCCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 167}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118535593 Original CRISPR CATTTACTACCCATTTCCCC CGG Intronic
901503922 1:9672017-9672039 CATCTCCTACCCACTCCCCCTGG - Intronic
901705848 1:11072497-11072519 CATTTACTGACCATGTCCCTTGG - Intronic
905387963 1:37617224-37617246 CACTAACAACCCCTTTCCCCAGG - Intronic
908092796 1:60704241-60704263 CATTTATTACCCACTTCTACAGG + Intergenic
908307045 1:62830467-62830489 CATTTGCAACCCATTCCACCAGG - Intronic
910276574 1:85455638-85455660 CATTTACTCTCCATTTCTTCAGG + Intronic
911686057 1:100779111-100779133 CATTCACCACCCCTTTCTCCTGG + Intergenic
912162551 1:107003381-107003403 CAATTCCTCCCTATTTCCCCAGG - Intergenic
913973577 1:143435782-143435804 CATTTACTTCTCATTTCCATAGG - Intergenic
914067965 1:144261389-144261411 CATTTACTTCTCATTTCCATAGG - Intergenic
914111190 1:144704965-144704987 CATTTACTTCTCATTTCCATAGG + Intergenic
915419272 1:155766503-155766525 CAGTTGCCACCCGTTTCCCCAGG - Exonic
916594924 1:166234451-166234473 CATTAACTCACCAATTCCCCTGG + Intergenic
919108601 1:193188619-193188641 CATTCCCTACCCCTTTCTCCAGG + Intronic
919749488 1:201028071-201028093 AATTTCCTTCCCATTTCCCTCGG + Intergenic
919958579 1:202442616-202442638 CAATCATTACCCATTTCCCATGG - Intronic
920052866 1:203174058-203174080 CATTTTCTGCCCATTTCCTGTGG - Intronic
922395480 1:225196166-225196188 CCCTTCCTACCCATTCCCCCTGG + Intronic
924084956 1:240441354-240441376 CATTTCCTATCCATGTCCCAGGG - Intronic
1064650742 10:17506983-17507005 GATTTACTTCCCATTTTCACTGG - Intergenic
1068816987 10:61327649-61327671 CAATTACTATCTCTTTCCCCTGG - Intergenic
1073803013 10:107064392-107064414 CTTTTCCTCACCATTTCCCCCGG - Intronic
1075702248 10:124477283-124477305 CATTGACCACCCCCTTCCCCGGG - Intronic
1079503470 11:21128719-21128741 CATTTACTACCACACTCCCCTGG - Intronic
1080421580 11:32115802-32115824 TATTGACTTCCCATTGCCCCAGG - Intergenic
1086904100 11:92399272-92399294 CATCTACTGACCATTTCCTCTGG + Intronic
1088720474 11:112587850-112587872 CATTTCATACCCATTGCCCAGGG + Intergenic
1089382314 11:118043847-118043869 CCTTTTCTCCCCACTTCCCCTGG - Intergenic
1091562899 12:1628499-1628521 CAATAACTACAGATTTCCCCAGG - Intronic
1094757803 12:33492536-33492558 CAGATACTACGCATTTCCCATGG + Intergenic
1106851727 13:33800620-33800642 CATTTAGTAACCATTTCCTTTGG + Intergenic
1108332235 13:49399583-49399605 AATTTAGAACCCATTTTCCCTGG - Intronic
1108413506 13:50174127-50174149 CATTTATTTTCCAGTTCCCCAGG + Intronic
1108832965 13:54501494-54501516 CATCAACTATCCATTTTCCCTGG + Intergenic
1110713085 13:78671434-78671456 CTTTTACCTCCCATTTCTCCTGG + Intergenic
1110718051 13:78730422-78730444 CACTTACTACCTATGTGCCCTGG - Intergenic
1110982372 13:81917206-81917228 CCCTTTCTACCCCTTTCCCCAGG - Intergenic
1112027246 13:95422742-95422764 CATATACTACCCAACTCTCCTGG + Intergenic
1113042719 13:106122186-106122208 CATTTACTACCAATTACCTGTGG - Intergenic
1113460105 13:110476281-110476303 CACTAACAATCCATTTCCCCTGG + Intronic
1115192439 14:30760161-30760183 CAGTCACTACACATTTCCCACGG + Intergenic
1115779789 14:36756577-36756599 CACTGCCTACCCATTTCCCTTGG + Intronic
1116557798 14:46334779-46334801 CTTTTCCTACCCATGTCCTCTGG - Intergenic
1118535593 14:66760113-66760135 CATTTACTACCCATTTCCCCCGG + Intronic
1118619990 14:67606134-67606156 CAATTACTAGCCATTTTCACTGG - Intergenic
1118792537 14:69108233-69108255 CTTTTACTCACCATGTCCCCCGG - Intronic
1119769743 14:77213000-77213022 CATTGAGTATCTATTTCCCCTGG - Intronic
1124700317 15:31906918-31906940 CATTTATTATGCAATTCCCCAGG + Intergenic
1127414175 15:58741030-58741052 AATTTACTACCCCTTTTCCTAGG - Intronic
1130008606 15:80128166-80128188 CAATTACTCCCCACTTCCCACGG - Intronic
1131667917 15:94590090-94590112 CCTTTCCTACCCACTTCCCAGGG - Intergenic
1133449607 16:5892730-5892752 CATTTTCTCCCCACTACCCCTGG - Intergenic
1133991081 16:10708070-10708092 CATTTACTACCCATATAGCGGGG - Intergenic
1137963727 16:52910886-52910908 CATGGACTTCCCATTTCCCCTGG - Intergenic
1138005069 16:53326643-53326665 GAATTACTACCCACTTCTCCTGG - Exonic
1138843712 16:60539443-60539465 CATATACTACACTTTTCCCATGG - Intergenic
1139470473 16:67175395-67175417 CATACACAACCCATTTCCCCTGG + Exonic
1139917321 16:70436896-70436918 CATTTCCCACCCCTCTCCCCAGG + Intronic
1140879348 16:79183690-79183712 CATTTAATACCCATTACCTACGG + Intronic
1147190008 17:38732888-38732910 CATTTACTTCCCATGTTCCTGGG - Intronic
1148962501 17:51405235-51405257 CCTTGGCTTCCCATTTCCCCTGG + Intergenic
1149383284 17:56116091-56116113 CATTTCCCAGCCATGTCCCCAGG + Intronic
1154123739 18:11671940-11671962 CATTTACCATCTATTTCCTCTGG - Intergenic
1156188433 18:34690306-34690328 AAGTTACTACCCTTTTCCCATGG - Intronic
1158198791 18:54917117-54917139 CATTCACTTCCCCTTTCCTCAGG - Intronic
1159375836 18:67591822-67591844 CATTGTCTTCCCATTTCTCCTGG + Intergenic
1160342305 18:78100206-78100228 CATTTACTTCCCTTTTCAACTGG - Intergenic
1160346286 18:78135075-78135097 GATCTCCTTCCCATTTCCCCAGG - Intergenic
1162134243 19:8545422-8545444 CATTCAATAAACATTTCCCCGGG - Intronic
1163437703 19:17305164-17305186 CCTTGGCTCCCCATTTCCCCAGG - Intronic
1164774818 19:30844752-30844774 CATTTCCTACCCATGTCCCCTGG - Intergenic
1167014822 19:46834229-46834251 CATCTCCCTCCCATTTCCCCTGG + Intergenic
928496769 2:31840667-31840689 TTTTTACTCCCCATTTCCACTGG + Intergenic
929322731 2:40565115-40565137 GATTTTTTACCCAATTCCCCTGG + Intronic
930940028 2:57001040-57001062 CATTCACTCACCATTTCCCTGGG + Intergenic
932544689 2:72695788-72695810 CATTTACTAACCATTTCTGAAGG + Intronic
933365403 2:81347356-81347378 CATTTACTCACCACTTCCCTTGG - Intergenic
934178271 2:89596748-89596770 CATTTACTTCTCATTTCCATAGG - Intergenic
934288566 2:91671040-91671062 CATTTACTTCTCATTTCCATAGG - Intergenic
936452132 2:112641614-112641636 CAGTCATTTCCCATTTCCCCCGG - Intergenic
939866575 2:147479652-147479674 CATTAACTACCCAATTCTCTGGG + Intergenic
942239480 2:173946493-173946515 CATTTCCAACTCATTTCCTCAGG + Intronic
942363860 2:175200909-175200931 CAATAACTCCCAATTTCCCCTGG - Intergenic
942858196 2:180577384-180577406 CATTGACTACCCAGTGCCACAGG - Intergenic
945773089 2:214069617-214069639 CTTTTACCACCCATCTCCCTTGG - Intronic
946270830 2:218592228-218592250 CATTTTCTACTCATTTTCCCAGG - Intronic
1170257795 20:14364585-14364607 CAGTTACTCCCTATTTTCCCTGG + Intronic
1171000795 20:21413796-21413818 CAGATACTACACTTTTCCCCTGG + Intergenic
1178927127 21:36785430-36785452 CATTTTCTACCCATCTCTCCCGG + Intronic
1179510832 21:41872184-41872206 CATTTGCTATCCCATTCCCCAGG + Intronic
1184488764 22:44797012-44797034 CATAGACCTCCCATTTCCCCCGG + Intronic
1185006456 22:48279528-48279550 CATTTACTAATTATGTCCCCAGG + Intergenic
950873265 3:16247660-16247682 CATTTACAACACACTTTCCCAGG - Intergenic
951018550 3:17756869-17756891 CATTTAACACCCATTTCACCAGG + Intronic
955879051 3:63524374-63524396 CATGTGCTACCCATATCCCCTGG + Intronic
958637199 3:96760800-96760822 CATTTGCTATCTATTGCCCCTGG + Intergenic
959430257 3:106245715-106245737 CATTTAATTTCCACTTCCCCTGG - Intergenic
961619267 3:128210687-128210709 CAATTCCTACGGATTTCCCCTGG + Intronic
963221627 3:142819319-142819341 CCTTTAGTTCCCCTTTCCCCTGG + Intronic
964010313 3:151885111-151885133 CATATACTACGCTTTTCCCAAGG + Intergenic
964918745 3:161869934-161869956 TATTTTCTATCCATTTCCACTGG + Intergenic
965044373 3:163556720-163556742 CATTTTGTACCCTTTTCTCCTGG + Intergenic
966660861 3:182412793-182412815 CATTTACCAGCCATTTACTCTGG + Intergenic
966989181 3:185211278-185211300 CCTTTCCTCCCCATTTCCCTGGG - Intronic
967343606 3:188428085-188428107 CAGATACTACCCTTTTCCCATGG - Intronic
969830975 4:9796647-9796669 CATTTACTTCTCATTTCCATAGG + Intronic
970307158 4:14744734-14744756 CATTTGGTACCCATTGCCCATGG - Intergenic
970551365 4:17185167-17185189 CAATTATTACCCACATCCCCAGG + Intergenic
970614894 4:17759875-17759897 CATTTACTTCCCATATCTACAGG + Intronic
971659475 4:29393445-29393467 CAATTACTGCCCAATTCCTCTGG - Intergenic
971739502 4:30502221-30502243 CATTTAGTATCCATTTCTACAGG - Intergenic
973717929 4:53695678-53695700 CATTCATTACCCATGGCCCCAGG - Intronic
975269064 4:72407609-72407631 CATTTATCACCCATTTCCTGTGG - Intronic
975373278 4:73612960-73612982 CTTTTCTCACCCATTTCCCCTGG + Intronic
975734327 4:77366880-77366902 CAGTTACTAGCCATGTCCTCGGG - Intronic
977234546 4:94492539-94492561 TATTTACTCCCCATTTCTCCTGG + Intronic
978070490 4:104462043-104462065 TATATACTAACCATTCCCCCTGG + Intergenic
978845622 4:113269446-113269468 CAGATACTACGCATTTCCCATGG - Intronic
979022923 4:115525456-115525478 CAGATACTACCCTTTTCCCATGG - Intergenic
979355289 4:119696456-119696478 CATTTATTGCACATTTGCCCTGG - Intergenic
982670483 4:158314268-158314290 CCTTTACTCACCCTTTCCCCAGG + Intergenic
983949511 4:173622730-173622752 CAGATACTACCCTTTTCCCATGG - Intergenic
984400309 4:179256179-179256201 CATTTTCCACTCATTTCCCTGGG + Intergenic
990273216 5:54168213-54168235 CGCTTTCTACCCATTACCCCTGG + Intronic
994897107 5:105720926-105720948 CATTTACTCACCACTTCCCTGGG - Intergenic
996246253 5:121267179-121267201 CCTTTTCTACCCATTGCCCTAGG + Intergenic
996337860 5:122404224-122404246 CATTTACTACCCATATGGCAAGG + Intronic
997833716 5:137175214-137175236 CTTGTACTACCCATTTTCCAAGG - Intronic
998054539 5:139063141-139063163 CATTTCCTACCCATTCCTCTGGG - Intronic
999476827 5:151907928-151907950 CATTCTCTAGTCATTTCCCCAGG + Intronic
1003206788 6:4020159-4020181 CATTTAAAACCCTTCTCCCCTGG + Intergenic
1007643001 6:43357900-43357922 CATTTCCTCTCCCTTTCCCCAGG + Intronic
1007818453 6:44541847-44541869 CACTTACTGCCCCTCTCCCCTGG - Intergenic
1008525231 6:52400935-52400957 CATTTACTACGCACTTACCTTGG + Intronic
1011979059 6:93348815-93348837 TATTTACTAACCATCTACCCTGG + Intronic
1012575004 6:100783992-100784014 AATTTACTAGCCATTTATCCTGG - Intronic
1014124078 6:117757951-117757973 CATTTACTCACCTCTTCCCCTGG - Intergenic
1014922374 6:127228456-127228478 CAGTTACTACACTTTTCCCATGG + Intergenic
1016075020 6:139785699-139785721 CATTCACTAACCACTTCCCTGGG + Intergenic
1016305045 6:142675414-142675436 CATTTTCTACCCCTTTCCGAAGG - Intergenic
1018976821 6:168572975-168572997 CATTTCCTCCCCACATCCCCGGG + Intronic
1018976855 6:168573099-168573121 CATTTCCTTCCCACATCCCCGGG + Intronic
1018976888 6:168573223-168573245 CATTTCCTTCCCACATCCCCGGG + Intronic
1018976921 6:168573347-168573369 CATTTCCTTCCCACATCCCCGGG + Intronic
1022832978 7:34086837-34086859 CATTTACTACACAATTCCATGGG + Intronic
1027357082 7:77368126-77368148 CATTTACTCACCACTTCCCTGGG + Intronic
1029342780 7:99958359-99958381 CTATTACTCCCCATTTCACCGGG + Intergenic
1029998214 7:105030729-105030751 CATTTTCTACTCCTATCCCCAGG + Intronic
1033707794 7:143905574-143905596 CTTTTACTGCTCATTTCCCTTGG - Intergenic
1033804734 7:144940904-144940926 CATTCAATATACATTTCCCCAGG + Intergenic
1034787863 7:153941883-153941905 CCTTTCCTACACACTTCCCCAGG + Intronic
1034888026 7:154813806-154813828 CTTTTACTACCCATTTCACAGGG - Intronic
1036926517 8:12911781-12911803 CAGTTTCTCCCCCTTTCCCCTGG - Intergenic
1037603754 8:20420598-20420620 GACTTACAAGCCATTTCCCCAGG + Intergenic
1038148018 8:24915519-24915541 CACTTGCTACCCCTTCCCCCTGG - Intronic
1039771300 8:40689568-40689590 CATTTACTACCCATTATTTCAGG + Intronic
1044125682 8:88456427-88456449 CATTTACTCACCACTTCCCTGGG - Intergenic
1044318226 8:90773997-90774019 CATTTTGTGCCCACTTCCCCAGG + Intronic
1045310081 8:100993497-100993519 CATTTACTTGGCATTTCACCCGG - Intergenic
1046556430 8:115779149-115779171 CAATTAGTACACATTTCCTCAGG + Intronic
1048235463 8:132685387-132685409 CAGTTACTGGCAATTTCCCCAGG - Intronic
1049970607 9:818696-818718 CCTTTACTATCTATTTTCCCCGG + Intergenic
1050420220 9:5456397-5456419 AATCTATTACCCATTTCCCAGGG + Intronic
1050630870 9:7557106-7557128 TATTTAGTACCCATGTCCTCTGG - Intergenic
1051230406 9:14949702-14949724 CAGATACTACCCTTTTCCCATGG + Intergenic
1051470121 9:17429682-17429704 CATTTACTAACCATGACCCATGG - Intronic
1051755128 9:20391167-20391189 TTTTTTCTACCCAATTCCCCAGG - Intronic
1052455763 9:28695512-28695534 TATTTACTACCCATTTATCAAGG - Intergenic
1052764688 9:32629378-32629400 CATTTTCCTACCATTTCCCCTGG + Intergenic
1055600071 9:77907289-77907311 CATTTTCTGACCATTTCCCATGG - Intronic
1059060288 9:111028989-111029011 CATTTCCTTCCTATCTCCCCAGG + Intronic
1185482868 X:460598-460620 CCTTTTCTCCCCATTCCCCCTGG - Intergenic
1188857647 X:35217005-35217027 CATTTATTACCCCTTTCTCTGGG + Intergenic
1192478554 X:71464983-71465005 CATTTTCCTACCATTTCCCCTGG - Exonic
1192958229 X:76096016-76096038 CAGATACTACACATTTCCCATGG - Intergenic
1193525341 X:82581504-82581526 CAAATACTACGCATTTCCCATGG - Intergenic
1193625931 X:83819856-83819878 CAATTACTCACCACTTCCCCTGG + Intergenic
1194055740 X:89128785-89128807 CATTTACTCACCACTTCCCCAGG + Intergenic