ID: 1118537392

View in Genome Browser
Species Human (GRCh38)
Location 14:66783057-66783079
Sequence CTAGACAAACAGGCTTTTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 242
Summary {0: 1, 1: 1, 2: 1, 3: 21, 4: 218}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118537392_1118537399 18 Left 1118537392 14:66783057-66783079 CCTACAAAAGCCTGTTTGTCTAG 0: 1
1: 1
2: 1
3: 21
4: 218
Right 1118537399 14:66783098-66783120 GGTCACCTAAGAGGCAAGAATGG 0: 1
1: 0
2: 0
3: 15
4: 190
1118537392_1118537394 -10 Left 1118537392 14:66783057-66783079 CCTACAAAAGCCTGTTTGTCTAG 0: 1
1: 1
2: 1
3: 21
4: 218
Right 1118537394 14:66783070-66783092 GTTTGTCTAGCCAACAGACAAGG 0: 1
1: 0
2: 0
3: 17
4: 145
1118537392_1118537395 -4 Left 1118537392 14:66783057-66783079 CCTACAAAAGCCTGTTTGTCTAG 0: 1
1: 1
2: 1
3: 21
4: 218
Right 1118537395 14:66783076-66783098 CTAGCCAACAGACAAGGACAAGG 0: 1
1: 0
2: 2
3: 20
4: 195
1118537392_1118537396 -3 Left 1118537392 14:66783057-66783079 CCTACAAAAGCCTGTTTGTCTAG 0: 1
1: 1
2: 1
3: 21
4: 218
Right 1118537396 14:66783077-66783099 TAGCCAACAGACAAGGACAAGGG 0: 1
1: 0
2: 1
3: 23
4: 222
1118537392_1118537398 9 Left 1118537392 14:66783057-66783079 CCTACAAAAGCCTGTTTGTCTAG 0: 1
1: 1
2: 1
3: 21
4: 218
Right 1118537398 14:66783089-66783111 AAGGACAAGGGTCACCTAAGAGG 0: 1
1: 0
2: 2
3: 9
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118537392 Original CRISPR CTAGACAAACAGGCTTTTGT AGG (reversed) Intronic
901139418 1:7018831-7018853 CTAGCCAGACAGGCTTTTCTAGG - Intronic
903835894 1:26203039-26203061 CCAGACAAACGGGATTTTGAGGG - Intergenic
906482837 1:46211175-46211197 CTAAACAGACAGGCTTTGCTGGG - Intronic
906933248 1:50189686-50189708 TGAGTCATACAGGCTTTTGTGGG - Intronic
907864299 1:58384609-58384631 GCAGACAGACAGCCTTTTGTGGG - Intronic
909041466 1:70657815-70657837 CTATACAAAGAGGCATTTTTGGG + Intergenic
909078721 1:71083636-71083658 CAAGACATACAGGTTTCTGTCGG + Intergenic
909695080 1:78458878-78458900 GTAGACAAACAGCCTTCTATTGG + Intronic
910241967 1:85096604-85096626 CTAGAGAAACAGGATATTGGAGG - Intronic
911125436 1:94337158-94337180 CCAGACAGACAGGCTTTGCTGGG - Intergenic
911771166 1:101744245-101744267 CTAGACAGACAGGCCTTACTGGG + Intergenic
914881803 1:151552974-151552996 CTAGACAGACAGGCCTTGCTGGG - Intronic
920910377 1:210210720-210210742 CTAGACAGACAGGCCTTGTTGGG + Intergenic
922901775 1:229142727-229142749 CTAGACAGACAGGCCTTGCTGGG + Intergenic
923135190 1:231111115-231111137 CTAGATAAGTGGGCTTTTGTTGG - Intergenic
923294859 1:232584162-232584184 CTAGACAGACAGGCCTTGCTGGG + Intergenic
1063432644 10:6004532-6004554 CTATACAAACAGAATTTTGGTGG + Intergenic
1064284775 10:13982620-13982642 CTAGACAGACAGGCCTTACTGGG + Intronic
1064412271 10:15116618-15116640 CCAGAGAACCAGACTTTTGTTGG - Intronic
1065864911 10:29906271-29906293 CTAGACAGACAGGCCTTGCTGGG - Intergenic
1068620144 10:59173578-59173600 CTAGACAGACAGGCCTTTCTGGG - Intergenic
1068683119 10:59841257-59841279 CTAGCCAAATAGATTTTTGTGGG - Intronic
1069235555 10:66067358-66067380 CTAGACAGACAGGCCTTGCTGGG + Intronic
1070278058 10:75026803-75026825 CTGGACCTACCGGCTTTTGTTGG - Intronic
1071425867 10:85549399-85549421 ATAGCCAATCAGGCTTTTGTGGG - Intergenic
1071758988 10:88579202-88579224 CTAGACAGACAGGCCTTGGTGGG - Intronic
1074742212 10:116496464-116496486 CTATGCAAACTGGCTTTTGGAGG + Intergenic
1075256509 10:120929845-120929867 CTAGACAACCAGTCTGATGTGGG - Intergenic
1075384404 10:122044810-122044832 GTAAACAAACAGTCTTTCGTTGG - Intronic
1076832985 10:133006258-133006280 CTGGAGACACAGGGTTTTGTGGG + Intergenic
1078756895 11:14219653-14219675 CTAGAAAGACAGGAGTTTGTCGG + Intronic
1083975103 11:66112218-66112240 CAAGCCAAACAGGATCTTGTAGG - Intronic
1086256436 11:84882264-84882286 CTAGGAAAACAGGTTCTTGTGGG + Intronic
1087171458 11:95053706-95053728 CTAGACATCCAGGCTTGTGATGG - Intergenic
1087540618 11:99513424-99513446 GTAGACAAAGAGCCTTCTGTTGG + Intronic
1087774118 11:102242337-102242359 CTAGAGAAACTGGCTGTTGTTGG + Intergenic
1088677749 11:112212695-112212717 CTGGACAAGCAGGCTTGGGTGGG - Intronic
1090268089 11:125367302-125367324 CAAGATAAGCAGGCTTTAGTGGG - Intronic
1091306971 11:134542552-134542574 CTAGACAGACAGGCCTTGCTGGG - Intergenic
1092669222 12:10843412-10843434 CTAAAATAATAGGCTTTTGTTGG + Intronic
1093006915 12:14061063-14061085 CTAGACAGACAGGCCTTGCTGGG + Intergenic
1093276880 12:17140083-17140105 CTAGACAGACAGGCTTTGCTGGG - Intergenic
1093396980 12:18694486-18694508 CTCCACAATTAGGCTTTTGTAGG - Intronic
1093657284 12:21709743-21709765 GTAGACAAACTGGCTATTTTAGG + Intronic
1095541303 12:43311318-43311340 CTAGACAGACAGGCCTTGCTGGG + Intergenic
1095586827 12:43859020-43859042 CTAGAGAAATAGGAGTTTGTGGG + Intronic
1098291769 12:68963264-68963286 CTAGACAGACAGGCCTTGCTGGG + Intronic
1098529161 12:71520882-71520904 CTAGACAGGCAGGCTAGTGTGGG + Intronic
1098788733 12:74793157-74793179 CTAGTCATGCAGGGTTTTGTAGG - Intergenic
1098961141 12:76740687-76740709 CTAGACAGACAGGCCTTGCTGGG - Intergenic
1101104395 12:101425679-101425701 CTAGACACACAGGCATTTCTGGG - Intergenic
1101461418 12:104899544-104899566 CTATACTAAAAGGCATTTGTTGG - Intronic
1103257300 12:119552923-119552945 CTTGGCAAACTCGCTTTTGTTGG - Intergenic
1106836530 13:33641100-33641122 CTAGACACACAGGCTTTGCTGGG - Intergenic
1106962435 13:35014739-35014761 CCAGACAAACAGGCCAATGTGGG + Intronic
1108152599 13:47551733-47551755 ACAGACAGACAGGGTTTTGTAGG + Intergenic
1110608915 13:77466793-77466815 CTGAACAAACAGGTTTTTCTTGG - Intergenic
1110617375 13:77556231-77556253 TTATAAAAACAGTCTTTTGTGGG + Intronic
1110947155 13:81436710-81436732 TAAGACAAATAGGCTTTTTTTGG + Intergenic
1111425265 13:88071779-88071801 CTCGACAGACAGGCTTTGTTGGG + Intergenic
1112971185 13:105265073-105265095 CTAGACAAATATGTTTTTGGGGG + Intergenic
1113783636 13:112990365-112990387 CTTGAAAAACAGGCTTCTCTGGG - Intronic
1116001149 14:39244015-39244037 CCAGACAGACAGGCTTTTCTGGG - Intronic
1116585559 14:46698323-46698345 CTAGACAGACAGGCCTTGATGGG + Intergenic
1117564612 14:56980190-56980212 TTTCACAAACAGGCTTTTGCTGG + Intergenic
1118537392 14:66783057-66783079 CTAGACAAACAGGCTTTTGTAGG - Intronic
1119231250 14:72981611-72981633 CTAGACCACCAGGATCTTGTGGG + Intronic
1119308923 14:73630540-73630562 CTAGACAGACAGGCCTTGCTGGG - Intergenic
1122422790 14:101588016-101588038 CTAGAGACAGGGGCTTTTGTTGG - Intergenic
1125042034 15:35199742-35199764 CAAGACAAAATGGCTTTTGGTGG + Intergenic
1125637948 15:41204951-41204973 CTAGACAGACAGGCCTTGCTGGG + Intronic
1128958609 15:71975727-71975749 CTAGACAAACAGGCCTTACTGGG + Intronic
1131008469 15:88997731-88997753 CTACACAAACAGGCCTTGCTGGG + Intergenic
1132019860 15:98351570-98351592 CTAGACAACCTTGCATTTGTGGG - Intergenic
1134682183 16:16134043-16134065 CTAAACAAATAGGGCTTTGTTGG + Intronic
1134895990 16:17887131-17887153 CTAGACAGACAGGCCTTGCTGGG + Intergenic
1137338890 16:47578916-47578938 CTAGAGAGACAGGCTTTTGTTGG + Intronic
1140264985 16:73412677-73412699 CAAGTTAAATAGGCTTTTGTGGG + Intergenic
1140937272 16:79684874-79684896 CTAGACCATCAGGCTTTCATGGG + Intergenic
1144299770 17:13912490-13912512 CTAGACAAACAGGCCCTGCTGGG + Intergenic
1146171823 17:30640371-30640393 CTGGACAAAGAGGGTCTTGTGGG + Intergenic
1146345278 17:32056396-32056418 CTGGACAAAGAGGGTCTTGTGGG + Intergenic
1147372230 17:40000662-40000684 GTAGACAAACAGCCTTCTATTGG + Intergenic
1151741047 17:75982217-75982239 CTAGACAGACAGGCCTTGCTGGG + Intronic
1152140759 17:78535024-78535046 CTAGACCAGCAGGCTTTCGAGGG + Intronic
1152311359 17:79552113-79552135 CCAGAAAAACAAGGTTTTGTGGG + Intergenic
1153505130 18:5789102-5789124 CTAGACAGACAGGCCCTTGCTGG - Intergenic
1153596041 18:6726141-6726163 CAAGACAGACAGGCTTTGCTGGG + Intergenic
1155472891 18:26209034-26209056 CAAAACAAACTGGCTTTGGTGGG + Intergenic
1157174973 18:45443407-45443429 CTAGACAGACAGGCCTTACTGGG - Intronic
1158038139 18:53059499-53059521 CTAAACATACAGGCTTGGGTTGG - Intronic
1159170597 18:64761485-64761507 CTCAACAAACAGGTTATTGTAGG + Intergenic
1161968145 19:7560548-7560570 CCAGAGAATCAGGCTTTTGAGGG + Intronic
1162680342 19:12335730-12335752 CTAGACACACAGGCCTTGTTGGG + Intergenic
1162990630 19:14299781-14299803 CTGGACAAAGAGGGTCTTGTGGG - Intergenic
1164964217 19:32466727-32466749 CTAGGCCAACAGTCTTTTGGAGG - Intronic
1165679502 19:37761674-37761696 CTAGACAGACAGGCCTTGCTGGG + Intronic
1166874222 19:45887248-45887270 CTAGAGAAAGGGGCTGTTGTGGG - Intergenic
929185738 2:39092002-39092024 GAAGAAAAACAGACTTTTGTGGG - Intronic
934061702 2:88300456-88300478 GTAGACAAACAGCCTTCTATTGG + Intergenic
937590843 2:123611379-123611401 CTAGACAGACAGGCCTTACTGGG + Intergenic
938743263 2:134252797-134252819 ATATACAAACAGGCTGTTGGGGG + Intronic
938943953 2:136193537-136193559 CTAGACACACAGGCCTTGCTGGG + Intergenic
939759747 2:146159964-146159986 CTTATCAAACAGGGTTTTGTGGG - Intergenic
940175097 2:150870140-150870162 CTAGACAGACAGGCCTTGCTGGG - Intergenic
940223831 2:151381682-151381704 CTAGACAGACAGGCCTTACTGGG + Intergenic
940773404 2:157862557-157862579 CTTTTCAAAGAGGCTTTTGTTGG - Intronic
944145003 2:196497848-196497870 CTAGACAGACAGGGCTTTCTGGG + Intronic
945346567 2:208724778-208724800 CTAGACAATGATGCATTTGTAGG - Intronic
947545932 2:231010351-231010373 CTAGACAGACAGGCCTTGCTGGG - Intronic
947869241 2:233423775-233423797 CTGGAAGAGCAGGCTTTTGTTGG + Intronic
1169441430 20:5636998-5637020 CTAGACAGACAGGCCTTGCTGGG - Intergenic
1169460069 20:5786714-5786736 CTAGACAGACAGGCCTTGCTGGG + Intronic
1169871355 20:10251784-10251806 ATAGGCAAACAAGCTTTTCTGGG - Intronic
1176735160 21:10539523-10539545 CACGACAGACAGCCTTTTGTGGG - Intronic
1177891618 21:26811203-26811225 CTACATAAACAGGCCTTTCTGGG - Intergenic
1178089461 21:29146215-29146237 ATAGACAAGCAGGCACTTGTTGG - Intronic
1179429127 21:41307073-41307095 GTAGACAAACAGCCTTATATTGG - Intronic
1180916616 22:19493205-19493227 CTAGACAGAGCAGCTTTTGTGGG + Intronic
1182204059 22:28605184-28605206 CTTGGAAACCAGGCTTTTGTGGG - Intronic
1182925855 22:34123982-34124004 CTAGACAGACAGGCCTTTCTGGG + Intergenic
1182992808 22:34784070-34784092 CTAGACAAACAGGCACTGGTTGG - Intergenic
949099369 3:125628-125650 CTGGACACACAGGGCTTTGTAGG + Intergenic
949306642 3:2649244-2649266 GTAGATAAACAGCCTTATGTTGG + Intronic
950838554 3:15944381-15944403 GTAGACATACAGGCTTCTATTGG + Intergenic
951074760 3:18376408-18376430 TTAGGGAAACAGGCTTTTGTAGG + Intronic
951805826 3:26642611-26642633 GTAGAGAAACAGGCCTGTGTGGG - Intronic
951895954 3:27609784-27609806 CTAGACAGACAGGCCTTGCTGGG + Intergenic
951918856 3:27831296-27831318 CTAGATAAAAAGGTTTTTCTAGG - Intergenic
951927684 3:27926132-27926154 CTATACAAACAAGCTTTTTTTGG + Intergenic
952217287 3:31290223-31290245 CTAGACAGACAGGCCTTGCTAGG - Intergenic
957356032 3:79087751-79087773 TTAGAAAAAAAGTCTTTTGTTGG + Intronic
958003890 3:87787924-87787946 CAAAACCATCAGGCTTTTGTTGG - Intergenic
963093024 3:141504409-141504431 CTAGAGACACAGCCTCTTGTTGG - Intronic
963918239 3:150880402-150880424 CTACACAAGCAGACTTGTGTAGG + Intronic
964185922 3:153942492-153942514 ATAGACAAACAGCCTTCTATTGG - Intergenic
964199894 3:154107405-154107427 CTAGGAAAATAGGCTTTTGCTGG - Intergenic
965977052 3:174638947-174638969 CTAGAAAGACATGCTTGTGTTGG - Intronic
966345164 3:178970803-178970825 CTAGACAGATAGGCTTTATTGGG + Intergenic
967298802 3:187991751-187991773 GTAGACAAAGAGTCTTTGGTTGG - Intergenic
971394082 4:26212743-26212765 CTAAACAGACAGGCTTTGCTGGG + Intronic
971881265 4:32376733-32376755 GTAGACAAACAGCCTTCTATTGG - Intergenic
972050204 4:34722034-34722056 GTAGACACACAGGCTTTGCTGGG + Intergenic
973721629 4:53729984-53730006 GTACACAAACAGGCTTTGGTGGG - Intronic
974464399 4:62235749-62235771 TTATACATACAGGCTTTTCTGGG + Intergenic
974467160 4:62272102-62272124 CTAGACAAAGAGGCCTTGCTGGG + Intergenic
974726508 4:65806050-65806072 CTAGACAGACAGGTTTTACTGGG - Intergenic
974799806 4:66802042-66802064 CTAGACAGACAGGCCTTGCTGGG + Intergenic
976231325 4:82846319-82846341 CTTGACAAAAAGGATTTTGATGG - Intronic
976549717 4:86380259-86380281 TGAGACAAACAGGTTTTTTTGGG - Intronic
977022620 4:91775647-91775669 CTCGAGAATCTGGCTTTTGTAGG - Intergenic
977137095 4:93318962-93318984 CAAAACAAACAGGGTTTTTTGGG - Intronic
980834464 4:138173894-138173916 CTATAAAAATAGGCATTTGTGGG + Intronic
981921293 4:150087677-150087699 CTAGACAGACAGGCCTTGCTGGG - Intronic
982441729 4:155443603-155443625 CTAGACAGACAGGCCTTGCTGGG - Intergenic
986585504 5:9312865-9312887 TGAGAAAAATAGGCTTTTGTGGG - Intronic
987765313 5:22220455-22220477 ATATATAAACAGGCTTATGTTGG - Intronic
988838020 5:35052800-35052822 CTAGACAGACAGGCCTTGCTAGG + Intronic
989641036 5:43583466-43583488 CTAGACAGACAGGCCTTTCTAGG - Intergenic
991703268 5:69334883-69334905 ATTGAAAAACAGGCTTTTGCGGG + Intergenic
992962475 5:81970115-81970137 CTAGACAGACAGGCCTTGCTGGG + Intergenic
995008402 5:107229493-107229515 CTAAACAGACAGGCTTTGCTGGG + Intergenic
995083961 5:108086309-108086331 CTAAACAGACAGGCCTTGGTGGG + Intronic
997088776 5:130831839-130831861 CTAGAGATACAGGCTCCTGTGGG - Intergenic
997502800 5:134390490-134390512 CAAGATACACAAGCTTTTGTAGG - Exonic
997506721 5:134423548-134423570 CTAAACAAACAGGCCTTACTAGG + Intergenic
997787210 5:136724378-136724400 CTAGACAGACAGGCCTTGCTGGG + Intergenic
998510077 5:142705880-142705902 GTAGACAAACAGCCTTCTATTGG + Intergenic
999545288 5:152622694-152622716 ATAGAACAACAGGCATTTGTTGG - Intergenic
999818335 5:155199859-155199881 CTAGACAGACAGGCCTTGCTGGG + Intergenic
999966715 5:156818351-156818373 CTAGACAGACAGGCCTTGCTCGG + Intergenic
999967098 5:156821314-156821336 CTAGACAAACAGGCCTTGCTGGG + Intergenic
1001626254 5:173136973-173136995 CTAGGAAAAAAGGTTTTTGTTGG - Exonic
1003972682 6:11314105-11314127 TTAGAAAAGCAGGCTTTTCTTGG + Intronic
1005460758 6:26067522-26067544 CTAGACAGACAGGCCTTGCTGGG - Intergenic
1005477378 6:26220772-26220794 CTAGACAAACAGGCCTTGCTGGG + Intergenic
1008082497 6:47209222-47209244 CTTGACCAACATGCTTTTTTAGG - Intergenic
1011501488 6:87995416-87995438 CCAGACAAAGAGGCTATTCTAGG - Intergenic
1011658624 6:89575058-89575080 GTAGACAGACAGGCTTTGCTGGG - Intronic
1015789548 6:136952529-136952551 CTAAACAAACAGGCCTTACTGGG + Intergenic
1015835843 6:137419113-137419135 CTGGACAAACAGGCCTTGCTGGG + Intergenic
1021034644 7:15783457-15783479 CTAGGCATACAGAATTTTGTTGG - Intergenic
1024815583 7:53265827-53265849 AAATACCAACAGGCTTTTGTGGG - Intergenic
1026103752 7:67404264-67404286 GCAGATAAACAGGCTTTTGATGG - Intergenic
1028145260 7:87314048-87314070 TTACACAAACAGTCTTTTGTTGG + Intergenic
1033754988 7:144390954-144390976 AAAGACAATTAGGCTTTTGTTGG - Intergenic
1034009715 7:147515872-147515894 CTACTGAATCAGGCTTTTGTAGG - Intronic
1034700534 7:153091858-153091880 CGAGTCAAACAGGCTCTTGCTGG - Intergenic
1034731824 7:153393510-153393532 CTAGCCAAGCAATCTTTTGTTGG + Intergenic
1035004655 7:155646317-155646339 CCAGATAAACAGGCATTTTTGGG + Intronic
1035105205 7:156436304-156436326 CTAGACAGGCAGGGTTTTCTGGG - Intergenic
1037281831 8:17249969-17249991 CTGAACAAACAGGCCTTGGTGGG - Intronic
1037387922 8:18363137-18363159 CTGGACAGACAGGCATTTCTGGG - Intergenic
1038297182 8:26304707-26304729 CAAGAGAAACAGGCTATTGTAGG + Intronic
1038417580 8:27408378-27408400 CTAGACAGACAGGCCTGTCTGGG + Intronic
1039569495 8:38575679-38575701 CTAGACAGATAGGCTTTGCTGGG + Intergenic
1039771823 8:40695004-40695026 CTAGACAGACAGGCTTTGCTAGG + Intronic
1043573667 8:81632112-81632134 CTAAACAGACAGGCTTTGCTGGG + Intergenic
1043706467 8:83357247-83357269 CTTGAAAAACAGGCTTATATAGG + Intergenic
1044712120 8:95068067-95068089 CTAGAGAAACAGGCTTTTGTTGG + Intronic
1047851776 8:128865041-128865063 CTGGACAGACAGGCCTTGGTGGG + Intergenic
1047853516 8:128884519-128884541 CTAGCCAAAGAGCATTTTGTAGG - Intergenic
1048293585 8:133198464-133198486 CTGGGAAAACAGGCTTGTGTAGG - Intronic
1048542622 8:135356124-135356146 CTAAACAAACAGGCCTTGCTAGG + Intergenic
1050658448 9:7855700-7855722 TTAGAAAAACAGGCTTCTATGGG - Intronic
1050755515 9:8998182-8998204 GCAGACAAACAGGCTTCTATTGG + Intronic
1051815117 9:21095788-21095810 CTAGACAGACAGGCCTTGCTAGG + Intergenic
1051816959 9:21120022-21120044 CTAGACAGACAGGCCTTGCTAGG - Intergenic
1052268195 9:26598385-26598407 CTAGACAAACAGTCCTTTCCTGG + Intergenic
1052755566 9:32537455-32537477 ATAGACAAAAAAGCATTTGTGGG - Intergenic
1053340015 9:37317849-37317871 TTGGATAAACAGGCTTTTTTGGG - Intronic
1055297064 9:74844335-74844357 GTAGACCAACAGCCTTATGTTGG - Intronic
1056073263 9:83010996-83011018 TTAGATAAATAGGCTTTTTTGGG - Intronic
1057345415 9:94246509-94246531 CTAGACAATCAGTCTTTCCTAGG - Intergenic
1057831796 9:98412858-98412880 CTAGACAGACAGGCCTTGCTGGG + Intronic
1058962822 9:110007915-110007937 CTAGACAGACAGGCCTTGCTGGG - Intronic
1059158620 9:112012555-112012577 GAAGTAAAACAGGCTTTTGTGGG - Intergenic
1059605512 9:115830552-115830574 AGAGACAAACAGGCATTTTTTGG + Intergenic
1060404274 9:123365539-123365561 CTAGAAGAAGAGGCTTTTGAAGG - Intronic
1061255854 9:129453951-129453973 CTAGACAGACAGGCAGTTGATGG + Intergenic
1061875110 9:133539706-133539728 CTGGACAAAAATGCCTTTGTCGG + Intronic
1186568042 X:10685597-10685619 CTAGACAGACAGGCCTTGCTGGG + Intronic
1186717939 X:12273172-12273194 CTAGACAAAGAGGACTTTATAGG + Intronic
1186742849 X:12535967-12535989 CAAGACAGAGAGACTTTTGTGGG + Intronic
1186748177 X:12592158-12592180 CTGGACAGACAGGCCTTGGTGGG + Intronic
1186829893 X:13379681-13379703 CTAGACAGACAGGCCTTGTTGGG - Intergenic
1187235540 X:17463879-17463901 CTAGACAGACAGGCCTTGCTGGG - Intronic
1187446489 X:19365334-19365356 CTAGACAGACAGGCCTTGCTGGG + Intronic
1187842339 X:23501680-23501702 CTAGACAGACAGGCCTTGATGGG + Intergenic
1189060103 X:37744499-37744521 GTAGACAAACAGCCTTGTATTGG - Intronic
1191958553 X:66673541-66673563 CTAAACAAAAAGGCATTTATTGG + Intergenic
1192385416 X:70663092-70663114 ATAGTCAAAGAGGATTTTGTGGG - Intronic
1195352511 X:104008534-104008556 CTAGACAGACAGGCCTTGCTGGG + Intergenic
1196256133 X:113521395-113521417 CTAGACAGACAGGCCTTGCTGGG + Intergenic
1196306753 X:114112007-114112029 CTAGACAGACAGGCCTTCCTTGG - Intergenic
1197347408 X:125340940-125340962 CTACACACACAGGCTTTATTTGG - Intergenic
1197626318 X:128806074-128806096 GAAGTCAAACAGGCTTCTGTGGG - Intergenic
1201226390 Y:11822934-11822956 CTACACAGACAGGCTTTGCTAGG + Intergenic
1201774020 Y:17644988-17645010 CTAGACAGACAGGCATTGCTGGG + Intergenic
1201827537 Y:18261001-18261023 CTAGACAGACAGGCATTGCTGGG - Intergenic
1202116062 Y:21469635-21469657 CTACAGAGACAGGATTTTGTGGG - Intergenic
1202593170 Y:26509049-26509071 CATGACAGACAGCCTTTTGTGGG - Intergenic