ID: 1118540636

View in Genome Browser
Species Human (GRCh38)
Location 14:66820181-66820203
Sequence TATAATAAACAGAAATTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 878
Summary {0: 1, 1: 0, 2: 11, 3: 101, 4: 765}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118540636 Original CRISPR TATAATAAACAGAAATTGGA AGG (reversed) Intronic
903516482 1:23914389-23914411 TAAAATAAACAGGAAGTGGCTGG - Intergenic
903820935 1:26102026-26102048 AAAAATAAATAGAAATTTGAGGG - Intergenic
904017067 1:27430038-27430060 GATAAGAAACAGTAACTGGAAGG - Intronic
904127420 1:28251088-28251110 AAAAATAAAAAGAAATTGGCCGG + Intergenic
904178929 1:28652046-28652068 TAAAATAAACAAAAATTAGCGGG + Intergenic
904513083 1:31030322-31030344 AATTGTAAACAGACATTGGAAGG - Intronic
904979541 1:34485731-34485753 TATAAAAGAAAGAAAGTGGATGG + Intergenic
906050278 1:42865563-42865585 TATAATAGACTGAAAGTGAAGGG + Intergenic
906570784 1:46836791-46836813 AATAATAAAAAGAAATTAAAAGG + Intergenic
908173750 1:61533281-61533303 TATAATAAACAGAAATTTATTGG - Intergenic
908305442 1:62809881-62809903 TATAATATACACAAATTTGAAGG + Intronic
908937048 1:69388767-69388789 TGTATGAAACACAAATTGGAGGG - Intergenic
909040048 1:70638608-70638630 TATAATGAACAGAAATTTATTGG - Intergenic
909096637 1:71296183-71296205 TATCATAAAAAGAACATGGAAGG + Intergenic
909294933 1:73935483-73935505 TATAATGAACAGAAATTTATTGG - Intergenic
909395612 1:75168076-75168098 TATATTAGACAGAAAATGGGAGG - Intergenic
909584624 1:77275700-77275722 TGTAATTTTCAGAAATTGGAAGG - Intergenic
909738850 1:79002607-79002629 TAGAATAAACTGAATTAGGAAGG + Intronic
909994016 1:82257024-82257046 TACAATAAACAGTACTGGGATGG + Intergenic
910089999 1:83451081-83451103 TATAATAAAAAGAAATAGGATGG - Intergenic
910129342 1:83884937-83884959 TTTAAGAAACAGTAATTCGACGG + Intronic
910137950 1:83994882-83994904 TAGAATAAACTGAAATTTGAAGG + Intronic
910328789 1:86044248-86044270 TATAATAAACAGAAAGAATAAGG + Intronic
910335298 1:86121793-86121815 TATAATAACCAAATATTGGTTGG - Intronic
910676098 1:89818368-89818390 TATAAGCAACAGAAATTGGCTGG - Intronic
910699327 1:90056176-90056198 AATAAGATATAGAAATTGGAAGG + Intergenic
910915763 1:92286940-92286962 TATAATGAACAGAAATTCATTGG - Intronic
911164340 1:94711828-94711850 TATAAAGAACAGAAATTAGCTGG + Intergenic
911267169 1:95755329-95755351 TATAATGAACAGAAATTCGTTGG + Intergenic
911553275 1:99310721-99310743 TATAAAAGACAGAAATAGCAGGG - Intergenic
911830668 1:102546839-102546861 TATAATACACAGAAATTTATTGG + Intergenic
911844540 1:102734268-102734290 TATAATAAATTCAAATTTGAGGG + Intergenic
912006428 1:104906813-104906835 TATAATAAACAGAAATCTATTGG - Intergenic
912128464 1:106570626-106570648 TATATTTACCAGAATTTGGAAGG + Intergenic
912131035 1:106600582-106600604 TATAATGAACAGAAATTTACTGG - Intergenic
912160422 1:106976500-106976522 TATCATAAAAAGAAATTGAAAGG - Intergenic
912189085 1:107316597-107316619 TATAAAAAACAGATATTTTATGG - Intronic
912196056 1:107398283-107398305 TATAATAAAAAAAAATAGGATGG + Intronic
912222569 1:107695032-107695054 TTTACTAAACAGAAAAGGGAAGG + Intronic
913956007 1:143294181-143294203 TACATTAAACAGAAACTGAAGGG + Intergenic
913981427 1:143521259-143521281 TACATTAAACAGAAACTGAAGGG - Intergenic
914075800 1:144347914-144347936 TACATTAAACAGAAACTGAAGGG - Intergenic
914103378 1:144618582-144618604 TACATTAAACAGAAACTGAAGGG + Intergenic
914820488 1:151098338-151098360 TCTACTAAAAATAAATTGGATGG + Intronic
915047811 1:153033245-153033267 TGAAATAAACAGGAATTGGCTGG - Intergenic
915077670 1:153323410-153323432 TATAATAAACAGGAATTTATTGG - Intergenic
916590030 1:166181298-166181320 TTCAATAAAAAGAAACTGGAAGG - Intergenic
916772447 1:167925002-167925024 CATACTAAGCAAAAATTGGAGGG - Intronic
916888248 1:169091326-169091348 TGAAATAAACAGAATTTTGATGG - Intergenic
917291468 1:173476574-173476596 CATAACAAACAGAAAGGGGAGGG + Intergenic
917586231 1:176429899-176429921 TATAATGAACAGAAATTTATCGG + Intergenic
917779156 1:178373019-178373041 TATAAGAAAGATAAATTTGAAGG - Intronic
917851741 1:179070359-179070381 TATAATGAACAGAAATTTATTGG + Intronic
918282091 1:183017048-183017070 TACAATAAACACAATTTGGGTGG + Intergenic
918566283 1:185937262-185937284 TATAATGAACAGAAATTTATTGG + Intronic
918604409 1:186404687-186404709 GATAATACACAGAATCTGGAAGG + Intronic
918618372 1:186574544-186574566 TATAATAATCAGTAATTGCAAGG + Intergenic
918643043 1:186867162-186867184 AATAGTAAACACAAATTTGAAGG - Intronic
918724301 1:187897949-187897971 TAAAACAAACAAAAAGTGGATGG + Intergenic
919073871 1:192790588-192790610 TATGATTAACAGAAATTGAAAGG + Intergenic
919099240 1:193073733-193073755 TATAATAAAAAAAAATTAGCTGG - Intronic
919735107 1:200943862-200943884 TATAATAAACAGAAATTTATTGG - Intergenic
921404920 1:214768330-214768352 TAGAATTAAAGGAAATTGGAAGG + Intergenic
921422918 1:214969310-214969332 TATAATGAACAGAAATTTACTGG - Intergenic
921700870 1:218267201-218267223 TATAATAAACAGAAATTTATTGG + Intergenic
921826111 1:219673660-219673682 TATAATGAACAGAAATTCACTGG + Intergenic
921879032 1:220232539-220232561 CATAATGAACAGAAATTGATTGG - Intronic
922993636 1:229938855-229938877 TATAAGAAGCAGTAATTAGAAGG + Intergenic
923964565 1:239122938-239122960 AATAATAAAAAAAAATTGGCTGG + Intergenic
924371383 1:243354264-243354286 TAAAATCAACAGAAATTGCATGG + Intronic
924498797 1:244616453-244616475 TATAATAAACAGAAATTTATTGG + Intronic
924726176 1:246673186-246673208 TATAATGAACAGAAATTTATTGG - Intergenic
1062869331 10:886050-886072 TTTAAAAAACAGAAAATTGAAGG + Intronic
1063797847 10:9533234-9533256 TATACTCAACACAAAATGGAGGG + Intergenic
1064839636 10:19576483-19576505 TATAATATAGAGCAAATGGAAGG + Intronic
1065010781 10:21418891-21418913 TATAAAAAATAAAAATTGGCCGG + Intergenic
1065497180 10:26341462-26341484 TAAAGCAAACAGAAATTTGAGGG + Intergenic
1065841113 10:29702011-29702033 TAAAATAAACAAAAATTAGCCGG + Intronic
1065869060 10:29940652-29940674 TATAATGAACAGAAATTTATTGG - Intergenic
1066110485 10:32191755-32191777 TGGAATAAACATAAATTGGTTGG - Intergenic
1066322989 10:34324428-34324450 TATAATATACACACATTAGAGGG + Intronic
1066537912 10:36411336-36411358 TATAATAAACATAAATTTATTGG - Intergenic
1066644857 10:37595983-37596005 TATAATAAACATAAATTTATTGG - Intergenic
1066782130 10:38962846-38962868 TACATTAAACAGAAACTGAAGGG - Intergenic
1066941136 10:41880687-41880709 TGTAATAAACAGCAATGGAATGG + Intergenic
1066954984 10:42157780-42157802 TACATTAAACAGAAACTGAAGGG + Intergenic
1067162557 10:43839703-43839725 TATAATGAACAGAAATTCACTGG + Intergenic
1068159888 10:53250103-53250125 TATAATGAACAGAAACTGAGAGG - Intergenic
1068176050 10:53459909-53459931 AATAATACAAAGAAATTAGATGG - Intergenic
1068181912 10:53532174-53532196 TATTAGAAACAGAAGTTGAAAGG + Intergenic
1068218880 10:54017622-54017644 ATTAATAGACAGAAATTGGGTGG + Intronic
1068662949 10:59642123-59642145 TATAATAACCAGAATTTGTCAGG - Intergenic
1069109438 10:64427335-64427357 TATAATAAAAATAAAATAGAAGG + Intergenic
1070074512 10:73122153-73122175 TCTAAGAAACAGAAAGGGGAAGG - Exonic
1070452375 10:76574326-76574348 TATCACAAAAAGAAATTTGAAGG - Intergenic
1070578855 10:77703491-77703513 TATAATGAACAGAAATTTATTGG - Intergenic
1072200514 10:93153846-93153868 TACAATAAACAGAAATTTATTGG - Intergenic
1072512471 10:96141353-96141375 TATAAGAAGCAGAATTTGAAAGG + Intronic
1073040500 10:100601204-100601226 CATAATAAACAGAAATTTATTGG + Intergenic
1073090384 10:100933020-100933042 TATAATAAGTAGAAATTTGTAGG - Intronic
1074018526 10:109560556-109560578 TATAATGAACAGAAATTTATTGG + Intergenic
1074089457 10:110235050-110235072 TCTAAGAAGCAGAAATTGGATGG - Intronic
1074587863 10:114786465-114786487 TAAAATAAAAATAAATTTGAAGG - Intergenic
1075098998 10:119492821-119492843 TAAAAAAAACACAGATTGGAGGG - Intergenic
1075290979 10:121230701-121230723 TATAATAAACAGAAATGCACTGG + Intergenic
1075763589 10:124875332-124875354 TTTAAAAAACAAAGATTGGACGG - Intergenic
1075934198 10:126325582-126325604 TATAAGAAATGGAAAATGGAAGG - Intronic
1076346243 10:129780673-129780695 TATAATAGACAGAAAAGGGCCGG + Intergenic
1078025971 11:7696038-7696060 TACAAGAAACAGAAATGGAATGG - Intronic
1078063625 11:8063623-8063645 TATAATAGCAAGAAATTGGAAGG - Intronic
1078369622 11:10734197-10734219 TATAAGAAACAGAAAATGGCCGG + Intergenic
1078497112 11:11829031-11829053 TATAATAAATAAAATTTAGAAGG - Intergenic
1078509403 11:11974386-11974408 TATAATGAACAGAAATTTATTGG + Intronic
1079786899 11:24684612-24684634 AATAACAGATAGAAATTGGAGGG + Intronic
1080307796 11:30855106-30855128 TATAATGAACAGAAATTTATTGG - Intronic
1080351840 11:31393712-31393734 TATAAAAAACAGAAATTTATTGG - Intronic
1080371131 11:31645505-31645527 TATGAATAACAGAAATTGCAAGG - Intronic
1080903001 11:36513232-36513254 TATAATGAACAGAAATTTACTGG - Intronic
1080918173 11:36681240-36681262 GATAATAAAGAGGAAATGGAAGG - Intergenic
1081226459 11:40529347-40529369 TTTAAAAAAAAGAAATTGAAAGG + Intronic
1081228593 11:40556307-40556329 CATAACAAACAGAACTTGGTAGG - Intronic
1082908287 11:58337734-58337756 TATAATGAACAGAAATTTATTGG - Intergenic
1082941588 11:58710770-58710792 TATAATAAACAGAGATGAAATGG + Intronic
1083920030 11:65777626-65777648 TATAATAAACAGAAATGTATTGG - Exonic
1084819692 11:71677299-71677321 TAAAATAAACAAAAATAGGGCGG + Intergenic
1084919250 11:72455898-72455920 TAGAAGAAAGAGAAATTGTATGG - Intergenic
1085132869 11:74056878-74056900 TACAATAAAGAGAAATAAGAAGG - Intronic
1085840007 11:80000999-80001021 AATAATAAAAAAAAATTGTAGGG - Intergenic
1087236393 11:95723667-95723689 TATAATGAACAGAAATTTATTGG + Intergenic
1087287292 11:96278648-96278670 TTTACTAAACAGAAACTGGAAGG + Intronic
1087544601 11:99568764-99568786 TAAAATAAACAGAAAATATATGG - Intronic
1087943295 11:104127302-104127324 TATAATAATCAGAAGGTCGATGG - Intronic
1088364111 11:109020794-109020816 ACGAATAAACAGAAATTAGAGGG + Intergenic
1088885747 11:114005110-114005132 TAGAATCAACAGAACTTGGCTGG - Intergenic
1088963599 11:114695694-114695716 TATAAAAAGAAGAAATTGGCCGG + Intronic
1090501994 11:127269912-127269934 TTTAATAAAGAGAAATTAGAGGG + Intergenic
1090931626 11:131302720-131302742 TATAATGAACAGAAATTTATTGG - Intergenic
1091256472 11:134191398-134191420 AATGATAAACAGAGATTGCATGG + Intronic
1092606175 12:10122022-10122044 TAAAATAAAAATAAATTAGATGG + Intronic
1093008046 12:14072300-14072322 TAAAATATACTGAAATAGGAGGG + Intergenic
1093227028 12:16497249-16497271 AATAAGAAACAGAAATTGACAGG + Intronic
1093271695 12:17070282-17070304 TATAATAACCAAAAATAGCATGG + Intergenic
1093714253 12:22363465-22363487 TAAAATATACAAAAATTAGATGG + Intronic
1093790723 12:23246166-23246188 TATAATAAACAGAAATCTACTGG - Intergenic
1093874610 12:24335349-24335371 TATAATAAAATGAAAATGAAAGG - Intergenic
1093980761 12:25472767-25472789 TATAATTAACAGAAATTTATTGG + Intronic
1094064032 12:26344175-26344197 TATAATGAACAGAAATTTATTGG - Intronic
1094163632 12:27419276-27419298 TGTAATAAACAGAAATTATTTGG + Intronic
1094263792 12:28531006-28531028 TATAATGAACAGAAATTTCTTGG - Intronic
1094332477 12:29310063-29310085 TAGAAAAATCAGAAATCGGAAGG - Intronic
1094817153 12:34199321-34199343 TATAATAAATTGTAATGGGAAGG - Intergenic
1095261391 12:40103937-40103959 TACAATAAACAGCAAAAGGAAGG + Intronic
1095473998 12:42566403-42566425 GATGGCAAACAGAAATTGGAGGG + Intronic
1095560651 12:43561385-43561407 TATAAGAAACAAACATGGGAAGG + Intergenic
1095715910 12:45345841-45345863 TATAAAGAACAGAAATTGATTGG + Intronic
1095730099 12:45497354-45497376 TATAATGAACAGAAATTTATTGG - Intergenic
1095909784 12:47414560-47414582 TATAAAAAACAGATATTTCAAGG - Intergenic
1096248786 12:50013145-50013167 TATAATAGAAATAAATGGGAAGG + Intronic
1096438544 12:51617835-51617857 TGGAATAAACAGAAATAGAATGG - Intronic
1097311921 12:58128567-58128589 AATAATAAACACAAATTTCAGGG - Intergenic
1097370691 12:58776299-58776321 GATAAGAAACAGAAAAAGGAAGG + Intronic
1097481404 12:60130252-60130274 TAAAGAAACCAGAAATTGGAGGG + Intergenic
1097672698 12:62559005-62559027 TTTAATAAAAAGAATATGGAGGG + Intronic
1098323472 12:69276282-69276304 AATAATAAAAAAAAATTGGCCGG - Intergenic
1098379166 12:69850653-69850675 TATAATCAACAAAAATTGGAAGG - Intronic
1098392926 12:69988574-69988596 TATACTAACCAGAAATGGAAAGG - Intergenic
1098447685 12:70583980-70584002 TATAATTATCAGACATAGGATGG + Intronic
1098771823 12:74562087-74562109 TACAATAAACAGAAATTGATTGG - Intergenic
1098822904 12:75255199-75255221 TATAATAAAAATTAATAGGATGG - Intergenic
1098878710 12:75893757-75893779 AATAATGAACAGAACTCGGATGG - Intergenic
1098903607 12:76138653-76138675 TATATGAAAGAGAAATTGGTTGG + Intergenic
1099110830 12:78558711-78558733 TATAGAAAACAGACATTGAAAGG - Intergenic
1099122580 12:78710365-78710387 TATATTGAAGAGAAATTGAATGG + Intergenic
1099141919 12:78988758-78988780 TGTAATGAACAGCCATTGGAGGG + Intronic
1099172739 12:79384955-79384977 TATAATAAGCAGCTAATGGAAGG + Intronic
1099206663 12:79736421-79736443 TATAAGAGTCAAAAATTGGAGGG + Intergenic
1099559932 12:84160040-84160062 TTCAATAAAAATAAATTGGAAGG + Intergenic
1099599724 12:84718853-84718875 TATAATAAACAGAAACTTTTAGG - Intergenic
1099812452 12:87601352-87601374 TATAATGACGATAAATTGGAAGG + Intergenic
1099873559 12:88377180-88377202 TATAATAAACATAAATTTATTGG + Intergenic
1100650222 12:96579030-96579052 TATATAAACCAGAATTTGGAGGG - Intronic
1100919891 12:99470287-99470309 TATAATGAACAAGAATTGGCAGG - Intronic
1101104131 12:101423499-101423521 TATAATAAACAGAAATGTATTGG + Intergenic
1101539000 12:105647079-105647101 TATAATAAACAGCAATAGATTGG - Intergenic
1102293054 12:111716556-111716578 TTTAATAATAAGAATTTGGAAGG + Intronic
1102333971 12:112061447-112061469 CATAATTAACAGAAATTGAATGG + Intronic
1102535820 12:113580150-113580172 TGTAAGAAAAAGAAAGTGGAGGG + Intergenic
1102892281 12:116569156-116569178 TATAAAGAAAAGAAATTGGCCGG - Intergenic
1103260346 12:119582812-119582834 TATAATTAATAAAAATTGGGAGG - Intergenic
1103391265 12:120575231-120575253 TCTAAAAAACAAAAACTGGAGGG + Intronic
1104249109 12:127073073-127073095 TATAATAATCTGAAATCAGAGGG - Intergenic
1104262312 12:127195580-127195602 TCTAATACCCAGAATTTGGAGGG + Intergenic
1104304626 12:127598431-127598453 TAAAATTAAAAGAAAATGGATGG + Intergenic
1104389607 12:128380505-128380527 TCTAAGACAGAGAAATTGGAGGG + Intronic
1105900787 13:24750689-24750711 TATAAAAAACAGAAATCAGAAGG - Intergenic
1105968954 13:25410240-25410262 TTCAATAATCAGAAACTGGAGGG - Intronic
1106268491 13:28131652-28131674 AATAATAAAAATAAAATGGAAGG - Intergenic
1106687273 13:32074106-32074128 TTTAATAAACGGAAAATGAATGG + Intronic
1107146284 13:37063915-37063937 TATAATAAACAGAAGTTTATTGG + Intergenic
1107205171 13:37776570-37776592 TATAATAAAAACAAATAGAAAGG + Intronic
1107322439 13:39203906-39203928 AAGAAGAAACAGAAATTGGGAGG + Intergenic
1107525918 13:41231131-41231153 TATTAAAGACAGAAAGTGGATGG + Intronic
1107535416 13:41324668-41324690 AAAAAAAAACAGAAATTGGCCGG - Intronic
1107610165 13:42105122-42105144 TATAATGAACAGAAATTGACTGG + Intronic
1107665647 13:42687789-42687811 TCTAAAAAACAGAAATCTGAGGG + Intergenic
1107724384 13:43283422-43283444 AATAATAAACACAAAGTAGAGGG - Intronic
1107795833 13:44050757-44050779 TATAATAAACATAAATTTATGGG - Intergenic
1108026956 13:46188197-46188219 TATAATAAACAGAAATTCATTGG + Intronic
1108238892 13:48440789-48440811 CATAATAAATAGAAAATGAAAGG + Intronic
1108582077 13:51836313-51836335 TATAACAAACAGAAACTTGTTGG - Intergenic
1108932015 13:55837046-55837068 TATAAACAACAGAAATTTGTTGG + Intergenic
1109349015 13:61152769-61152791 TATAATGAATAGAAATTTAATGG - Intergenic
1109434580 13:62283146-62283168 AATAATAAAAAGAAATTTGGAGG + Intergenic
1109515637 13:63439983-63440005 TATAAACAACAGAAATTGGTCGG + Intergenic
1110325271 13:74206985-74207007 TATAATGAACAGAAATTTATTGG + Intergenic
1110473175 13:75883525-75883547 TATGAAAATCAGAAATTGCAGGG - Exonic
1110619985 13:77584634-77584656 TACAAAAAATAGAAATGGGATGG - Intronic
1110989163 13:82015260-82015282 TATAGTAAATAGATATTTGATGG + Intergenic
1111115647 13:83773385-83773407 AATAATAAACAGTAAATGGCCGG - Intergenic
1111230422 13:85338807-85338829 TTTAAGAAAAAGAAATGGGAGGG - Intergenic
1112311245 13:98319122-98319144 AAAAATAAACAAAAACTGGACGG - Intronic
1112615910 13:101005152-101005174 TATAATAAACAAAAATTTATTGG - Intergenic
1112720783 13:102242378-102242400 TATAATGAACAGAAATTAATTGG + Intronic
1112853777 13:103739355-103739377 TTTAAAATACAGAAATTGTAAGG - Intergenic
1113307147 13:109090854-109090876 GATAAGAAAGAGAAATGGGACGG - Intronic
1114943355 14:27645159-27645181 GATAATAAATAGATATAGGAGGG + Intergenic
1115040872 14:28925027-28925049 TATAATGAACAGAAATTTATTGG - Intergenic
1115104745 14:29746712-29746734 AATAATGAACAGAATTGGGAAGG - Intronic
1115420880 14:33194102-33194124 TATAATGGAGAGAAATTGGCTGG + Intronic
1115763580 14:36600076-36600098 TATAATAAGTAGAAGCTGGATGG + Intergenic
1115797199 14:36951349-36951371 AATAATAAACAGGAAATGCAGGG + Intronic
1116291102 14:43041622-43041644 TATAACAACCAAAAATTGGCTGG - Intergenic
1116375492 14:44194330-44194352 TTTAGTATACAGACATTGGAGGG - Intergenic
1116541064 14:46102026-46102048 TATAGTTAACATTAATTGGAAGG - Intergenic
1116600400 14:46915057-46915079 CATAGTAAACATAACTTGGATGG - Intronic
1117949113 14:61062973-61062995 TATAAAGAACAGAAATTGGCTGG - Intronic
1118067294 14:62206157-62206179 TATAATGAACAGAAATTTATTGG + Intergenic
1118075952 14:62299281-62299303 TGCAATAAACAAAAATTGCAGGG - Intergenic
1118221419 14:63857951-63857973 TATAATGAACAGAAATTTATTGG + Intronic
1118228891 14:63929427-63929449 TATGATAAAGAGTAATTGGATGG + Intronic
1118266195 14:64296815-64296837 AATAATAAGCAGAAAATGAATGG + Intronic
1118340199 14:64889492-64889514 TATAATAAACAGAATTTATTTGG + Intergenic
1118540636 14:66820181-66820203 TATAATAAACAGAAATTGGAAGG - Intronic
1119035403 14:71226331-71226353 TATAATAAACAGAAATTCATTGG + Intergenic
1120494232 14:85214447-85214469 TATAATAACCAGAAAATATAAGG + Intergenic
1120584999 14:86301406-86301428 TATAGTAAGTAGAAATTAGAAGG + Intergenic
1120800514 14:88683157-88683179 TCTAATAAAAAGTAATTGGGAGG + Intronic
1120811292 14:88806476-88806498 TATAATACAGTGTAATTGGATGG + Intergenic
1120964986 14:90159016-90159038 TATAATGAACAGAAATGGATTGG + Intronic
1123141555 14:106084108-106084130 TATAAAAAAAAGAGTTTGGAAGG - Intergenic
1123221678 14:106863327-106863349 TATAATAAACAAAAAAAGAAAGG - Intergenic
1202938514 14_KI270725v1_random:117706-117728 TACATTAAACAGAAACTGAAGGG + Intergenic
1124591336 15:31056145-31056167 AATAAAAAACCGAAAATGGACGG + Intronic
1124690950 15:31822386-31822408 AATAAATAACAGAAACTGGAGGG - Intronic
1125435525 15:39640748-39640770 AATGACATACAGAAATTGGAAGG + Intronic
1125776867 15:42223669-42223691 TATAATGAACAGAAATTTGTTGG - Intronic
1126030906 15:44496697-44496719 TAAAAAATACAGAAATTGGCCGG + Intronic
1126244010 15:46482042-46482064 TATAATGAACAGAAGTTTGTTGG - Intergenic
1126354016 15:47775707-47775729 TATAATAAACACCAATTTAATGG - Intergenic
1126358174 15:47818128-47818150 TATACAAAACAGTAATAGGATGG + Intergenic
1127148058 15:56045799-56045821 TATAATAAACATAAATTTAGAGG + Intergenic
1127441664 15:59015052-59015074 TAAAATAACAAGAAATTGGGTGG - Intronic
1127526812 15:59800883-59800905 TTTAAAAACAAGAAATTGGATGG + Intergenic
1128966979 15:72069222-72069244 AATAATAAAAAGAAACTAGAAGG + Intronic
1129378688 15:75152052-75152074 TGAAATGAACAGAAATAGGAAGG + Intergenic
1130607397 15:85330451-85330473 TACAGAAAACAGAAATTTGAAGG + Intergenic
1130626566 15:85521796-85521818 TATAATTTACAGAATTTGGTAGG - Intronic
1130717604 15:86351109-86351131 TATAATAAACAGAAATTTATTGG + Intronic
1130834240 15:87633479-87633501 TATAACAAACAGAAATTTATTGG - Intergenic
1132010542 15:98272255-98272277 TAATATAACCAGAAATTGAAAGG + Intergenic
1133003537 16:2864155-2864177 TATAATAAACAGAAATTCATTGG - Intergenic
1133058000 16:3156943-3156965 AATAATAAAAAGAAATTGGCCGG - Intergenic
1134839821 16:17392846-17392868 TAAAGTAAACATAAAGTGGAGGG - Intronic
1135138402 16:19901573-19901595 TATAAGCAACAGAAAATGGATGG + Intergenic
1135175508 16:20224524-20224546 TATAAGAAGAAGAAAGTGGACGG + Intergenic
1135477297 16:22788130-22788152 TATAAAAAAAAAAAACTGGAGGG + Intergenic
1135494851 16:22942432-22942454 AATAATAAACACAGAGTGGATGG + Intergenic
1136700777 16:32138601-32138623 TACATTAAACAGAAACTGAAGGG - Intergenic
1136766880 16:32788858-32788880 TACATTAAACAGAAACTGAAGGG + Intergenic
1136801215 16:33081520-33081542 TACATTAAACAGAAACTGAAGGG - Intergenic
1136936697 16:34474433-34474455 TACATTAAACAGAAATTGAAGGG + Intergenic
1136945038 16:34639500-34639522 TACATTAAACAGAAACTGAAAGG - Intergenic
1136947976 16:34678648-34678670 TACATTAAACAGAAACTGAAGGG - Intergenic
1136955362 16:34778530-34778552 TACATTAAACAGAAACTGAAGGG - Intergenic
1136959090 16:34825032-34825054 TACATTAAACAGAAACTGAAAGG - Intergenic
1136963122 16:34874137-34874159 TACATTAAACAGAAATTGAAGGG - Intergenic
1136967215 16:34928341-34928363 TACATTAAACAGAAACTGAAGGG - Intergenic
1137085030 16:36109514-36109536 TACATTAAACAGAAACTGAAGGG + Intergenic
1137087826 16:36150452-36150474 TACATTAAACAGAAACTGAAGGG - Intergenic
1137092268 16:36208608-36208630 TACATTAAACAGAAACTGCAGGG - Intergenic
1137221564 16:46456995-46457017 TACATTAAACAGAAACTGAAGGG + Intergenic
1137412689 16:48243102-48243124 TAAAAAAAAAAAAAATTGGACGG + Intronic
1137459267 16:48644630-48644652 TATTATAAAGAGATATTGGCCGG + Intergenic
1137816150 16:51399788-51399810 TATTATAAAAGGATATTGGAAGG - Intergenic
1138208781 16:55145500-55145522 TCTAATAAACACAGATTGGCAGG + Intergenic
1138729003 16:59174098-59174120 TAAAATAAAAAGAATTAGGATGG + Intergenic
1140384559 16:74523594-74523616 TATTATTAAGAGAAATTTGAAGG - Intronic
1140781049 16:78297188-78297210 TAAAATAAACACAATCTGGATGG - Intronic
1141109752 16:81262529-81262551 TTTAAACAACAGAAATTGGCTGG + Intronic
1141222823 16:82087706-82087728 TATAATGAACAGAAATTGATTGG + Intronic
1141318586 16:82985293-82985315 TATAGCAAAAAGAAATTAGAGGG + Intronic
1142278491 16:89135587-89135609 TATAAAAAAGATAAATTGGGAGG - Intronic
1203069275 16_KI270728v1_random:1051110-1051132 TACATTAAACAGAAACTGAAGGG + Intergenic
1142780076 17:2174876-2174898 TAGAATAAACAGAACTTCGAGGG + Intronic
1143886915 17:10071773-10071795 AATAATAAACAAAAATTAGCTGG + Intronic
1144146298 17:12401655-12401677 TCTATTAAACAGAAATTGTATGG + Intergenic
1144195546 17:12891328-12891350 TATAATAAACAAAAATTTATTGG + Intronic
1145326565 17:21834996-21835018 TACATTAAACAGAAACTGAAGGG - Intergenic
1145781242 17:27564928-27564950 TATTAAAAACAAAAACTGGAGGG - Intronic
1145821813 17:27843231-27843253 TAAAATTAACTGAAATTGGATGG + Intronic
1146253311 17:31370413-31370435 TATAAAAAAAAGAAACTGGAAGG - Intronic
1146447883 17:32947281-32947303 TAAAATAAATAGAATTTGGGTGG + Intergenic
1147682829 17:42263821-42263843 TATAATAAACAGATTATGGCTGG - Intronic
1148927849 17:51103238-51103260 GATAATTAACAGAAATTTGTTGG - Intronic
1149122329 17:53184669-53184691 TACATTAAAAAGAAATCGGAAGG - Intergenic
1149462839 17:56846702-56846724 TGTAAAAAATACAAATTGGAAGG - Intronic
1151039672 17:70844056-70844078 TATGACAATCAGAAAGTGGAAGG - Intergenic
1152287232 17:79420219-79420241 TTTAAAAAACACAAATTGGCTGG + Intronic
1203182817 17_KI270729v1_random:80130-80152 TACATTAAACAGAAACTGCAGGG - Intergenic
1203190756 17_KI270729v1_random:185587-185609 TACATTAAACAGAAACTGAAGGG - Intergenic
1153546764 18:6214981-6215003 TATAATTAACAGTATTTGGGGGG - Intronic
1153890585 18:9510742-9510764 TATAATAAAAAAAAATTAGCTGG - Intronic
1153916865 18:9753558-9753580 TATAAATAACAGAAAATGGATGG + Intronic
1153990607 18:10395687-10395709 TATAATAAACAGAAATGTATTGG - Intergenic
1154516451 18:15172186-15172208 TACATTAAACAGAAACTGAAGGG + Intergenic
1155240472 18:23859555-23859577 TATAATAAACAGCAATAGGAAGG - Intronic
1155600415 18:27539404-27539426 TAGTATAAACAGAAATCAGAAGG + Intergenic
1155865743 18:30962851-30962873 TATTATAAGCAGAAAGTGTATGG - Intergenic
1156374992 18:36505551-36505573 TATCATAAACTGAAAATGGAAGG + Intronic
1157087283 18:44593945-44593967 TATAATAAACAGAAATGTATTGG - Intergenic
1157414746 18:47492741-47492763 AATAATAAACAGAGTTTGCAGGG - Intergenic
1157679642 18:49594488-49594510 TTTAATAAATAGTAATTGGTAGG - Exonic
1158544035 18:58380570-58380592 TATAATAAAAAAAATTTGGGAGG - Intronic
1159654822 18:71020358-71020380 TATAATAAACAGAAATTTGTTGG - Intergenic
1159777910 18:72624806-72624828 TAAAGTAAAAAGAAATTGCAAGG - Intronic
1159877020 18:73823577-73823599 GATAATAAAAAGAAAATGAAAGG + Intergenic
1161013944 19:1974200-1974222 TATAATGAACAGAAATTGATGGG + Intronic
1162157257 19:8686947-8686969 GAAATTAAACAGAAATTTGATGG + Intergenic
1163874284 19:19853748-19853770 TAAAATAAATAGAAATTATATGG + Intergenic
1164014321 19:21239256-21239278 TTATAAAAACAGAAATTGGAAGG + Intronic
1164031462 19:21409894-21409916 TTATAAAAACAGAAATTGGAAGG - Intronic
1164830415 19:31315623-31315645 TATGATAAACAGAAATAAAAAGG + Intronic
1165675037 19:37715200-37715222 TTTAAGAAACAGAAAGTGGCTGG - Intronic
1165919365 19:39284533-39284555 TAAAATACACAGAGATTGGAAGG - Intergenic
1166515215 19:43441447-43441469 TAAAAGAAACAAAAATTGGTTGG + Intergenic
1167450492 19:49565450-49565472 TGTTATAAAAAGAAATTGGCTGG + Intronic
1168526438 19:57092155-57092177 TATAAACAACAGACATTGGCCGG + Intergenic
1202668989 1_KI270709v1_random:32026-32048 TACATTAAACAGAAACTGAAGGG - Intergenic
925036178 2:688071-688093 TATAATAAACAGAAATGTATTGG + Intergenic
925610754 2:5699876-5699898 TAAAATAAACAGAATTTTAAAGG + Exonic
925721747 2:6836005-6836027 TATAACAAAAATAAATTTGAAGG + Intergenic
926783953 2:16501707-16501729 GATAATAGAAAGAACTTGGAAGG + Intergenic
927063281 2:19444215-19444237 TATAATAAACAGACATTTATTGG + Intergenic
927223173 2:20734255-20734277 TACAATTAAAAGAAATTGGCAGG - Intronic
927317111 2:21696694-21696716 TCTCATAAACATAAATTGGCAGG + Intergenic
927482228 2:23463302-23463324 TATTATAAACAGACTTTTGAAGG - Intronic
927609528 2:24524249-24524271 TAAAATAAAAAGAAGTTGAAAGG - Intronic
928168720 2:28989699-28989721 TATAAAATACAAAAATTGGCTGG - Intronic
928267825 2:29826816-29826838 CATAAGGAACAAAAATTGGAGGG + Intronic
928600202 2:32896985-32897007 TATAATGAACAGAAATTGACTGG - Intergenic
928620342 2:33082300-33082322 TATAATGAGCAGAAATTGACTGG - Intronic
928831918 2:35496895-35496917 CATAATAAATGGAAATTGGTGGG - Intergenic
930184314 2:48396403-48396425 TAAAATAAAAAGAAATTAGCAGG - Intergenic
930338021 2:50075209-50075231 TAGAATAAATAGAATTTGCATGG - Intronic
930397215 2:50838162-50838184 GATAAGAAACATAATTTGGAAGG - Intronic
931073974 2:58688744-58688766 TATATTAAGCAAAAATTGGCAGG - Intergenic
931161182 2:59692264-59692286 TAAATTAAACAGAACTTAGAAGG + Intergenic
931440008 2:62282675-62282697 TATAATGAACAGAAATTTATTGG - Intergenic
931570657 2:63665901-63665923 TACTATAAACAGAAATTTTATGG + Intronic
931612893 2:64122907-64122929 TATTATAAAATGAAATTGGAAGG - Intronic
932157538 2:69432276-69432298 TATAAGAAACAGAATTGGGCTGG + Intronic
932187104 2:69707434-69707456 GAAAATAAACAGTAATTGGGAGG - Intronic
932193271 2:69759341-69759363 TGGAATAAACAGAAAGTAGATGG + Intronic
932272444 2:70422747-70422769 TATAATAAAGAGAAATTTATTGG + Intergenic
932898260 2:75666423-75666445 TATTTTATAAAGAAATTGGATGG + Intronic
933009797 2:77045983-77046005 TATAATTAAAAGAAAAAGGAAGG - Intronic
933555403 2:83824587-83824609 TATAAAGATCAGAAATTGTAGGG - Intergenic
934252299 2:90367841-90367863 TACATTAAACAGAAACTGAAGGG + Intergenic
934257143 2:91435104-91435126 TACATTAAACAGAAACTGAAGGG - Intergenic
935460746 2:103330624-103330646 TATAATAAAGAAATATGGGAAGG - Intergenic
935572483 2:104676634-104676656 TATAAACAACAGAAATTTGTTGG + Intergenic
936008030 2:108907347-108907369 TATAATAAAAACAAAGTGGCTGG + Intronic
936025360 2:109027528-109027550 TATCATAAACAGAGGGTGGATGG - Intergenic
936592114 2:113814026-113814048 TATAATAAACAGAAATTGATTGG + Intergenic
936650408 2:114420006-114420028 TATGTTAAACTGAAATTGAAGGG - Intergenic
937125146 2:119470342-119470364 TTTAATAATAAGAAATAGGATGG + Intronic
937491820 2:122377420-122377442 TCTAAGACACAGAAATTTGAAGG - Intergenic
937566998 2:123306125-123306147 TACAATGAACAGAAATTGATTGG - Intergenic
937568519 2:123327990-123328012 TATAATGAACAGAAATTTATTGG - Intergenic
938217405 2:129531893-129531915 TATAAATAAAAGAAATTAGAGGG + Intergenic
938516772 2:132017180-132017202 TACATTAAACAGAAACTGAAGGG + Intergenic
939261219 2:139812187-139812209 TATTTTAAAAAGAAATTGTATGG - Intergenic
939569536 2:143824386-143824408 TAAAATAAACAGAAAATGTGTGG - Intergenic
939633000 2:144547902-144547924 TACAATAAACAGAAATAACAAGG - Intergenic
939757549 2:146132904-146132926 TAGAATACACAGCAATTGTATGG - Intergenic
940101865 2:150049396-150049418 TTAAATTAAAAGAAATTGGAAGG + Intergenic
940142881 2:150513726-150513748 TATAAATGATAGAAATTGGAAGG + Intronic
940212071 2:151265125-151265147 TTTAATAAAATCAAATTGGAGGG + Intergenic
940534196 2:154917652-154917674 TATATTAAACAGAAATAAGAAGG - Intergenic
940692176 2:156932672-156932694 TATAATAAGCATAATTTTGATGG + Intergenic
940917480 2:159272930-159272952 AAAAATAAAAAGAAATTGGCAGG + Intronic
940932865 2:159456101-159456123 TTTAATACAAAGAAATTTGAGGG + Intronic
941301308 2:163805919-163805941 TATGATAAAAAGAAGTTAGATGG - Intergenic
941394086 2:164952846-164952868 TATTATATGCAGAAATTGAAGGG - Intronic
941673596 2:168320949-168320971 TTGAATGAAAAGAAATTGGAAGG + Intergenic
943040625 2:182800456-182800478 TATACAAAACAGAAATTGTAAGG - Intergenic
943054837 2:182963705-182963727 TTTAATGAAAAGAAATTTGATGG + Intronic
943197861 2:184778633-184778655 TATCATAACCAGAAATTTTAAGG + Intronic
943282425 2:185953263-185953285 TACAATAAACATAAACTTGAAGG + Intergenic
943539392 2:189193119-189193141 TATAATGAACAGAAATTTATTGG - Intergenic
943597274 2:189873590-189873612 TATATTAAACAGAAATGCAAAGG + Exonic
943618038 2:190116224-190116246 TATAATGAACAGAAATTTATGGG + Intronic
943764870 2:191649524-191649546 TATAATAAACAGGAATTAAATGG - Intergenic
944653028 2:201850993-201851015 TATAAAGAACAGAAATTGGCCGG + Intronic
944744302 2:202639971-202639993 TATAATAAAAAAAATTTGGTCGG + Intronic
944882635 2:204028938-204028960 TAGAAGGAACAGAAAATGGAGGG - Intergenic
945288374 2:208104923-208104945 TACAATAAAAAGAAAAAGGAAGG - Intergenic
945874227 2:215261161-215261183 TATAATTTACAGAAATTCAATGG + Intergenic
945942264 2:215961585-215961607 TATAAAATACAAAAATTAGACGG - Intronic
947211822 2:227715621-227715643 CAGAATAAACAGAATTTGGAAGG - Intronic
1169134257 20:3187273-3187295 TAAAATAAATAAAAATTGGCCGG + Intergenic
1169301808 20:4448876-4448898 AATAATAGACAGAAATAGCAAGG + Intergenic
1170468706 20:16646960-16646982 TAAAATAAAAAGAAATAGAAGGG - Intergenic
1171001376 20:21419232-21419254 CACAATAAAAAAAAATTGGATGG + Intergenic
1171421127 20:25018340-25018362 TATAATGAACAGAAATTTATTGG - Intronic
1171437809 20:25136613-25136635 TATAATGAACAGAAATTTATTGG - Intergenic
1171914912 20:31055631-31055653 TAAAATCAAGTGAAATTGGATGG + Intergenic
1171916621 20:31066541-31066563 TAAAATCAAGTGAAATTGGATGG + Intergenic
1171918034 20:31075541-31075563 TAAAATCAAGTGAAATTGGATGG + Intergenic
1171926131 20:31190140-31190162 TAGAATAAAAAGAAATGGAAAGG + Intergenic
1173295825 20:41755588-41755610 TATATAAAAAAGAAATTGGCTGG - Intergenic
1176584801 21:8571430-8571452 TACATTAAACAGAAACTGAAGGG - Intergenic
1177369348 21:20181157-20181179 CTTAATAAAAACAAATTGGAAGG - Intergenic
1177582658 21:23047200-23047222 TAGAATAAATAGAAATGGCAAGG + Intergenic
1180267612 22:10548332-10548354 TACATTAAACAGAAACTGAAGGG - Intergenic
1180370177 22:11976885-11976907 TACAAAAAACAAAAATTGGCCGG + Intergenic
1180919189 22:19510821-19510843 TATAATAAAAAGACACTGGCCGG - Intronic
1181260872 22:21596347-21596369 TAAAATAAAAAGAAATTGGCTGG - Intronic
1181386028 22:22546480-22546502 TATAAGAAATAGAAATTGGCTGG - Intergenic
1181995989 22:26882948-26882970 TATAGTAAACAGTAATTGCGTGG + Intergenic
1182565327 22:31194431-31194453 TATAAAAATGAGAAATTGGCCGG + Intronic
1182701664 22:32244951-32244973 CATAATAAAGAGGAATTGCAAGG + Intronic
1183288921 22:36986098-36986120 TGTAATAAACAGGAACTAGAAGG - Intergenic
1183793988 22:40100050-40100072 AATAATAAAAATAAAATGGAGGG - Intronic
1183997505 22:41646139-41646161 TAAAATAAAAAGAAATTAGCTGG + Intronic
1184145100 22:42605419-42605441 TATAAAAAACAGAAACTGCCGGG - Intronic
1184834415 22:47012612-47012634 TAAAATGAGCTGAAATTGGAAGG - Intronic
1203325651 22_KI270738v1_random:13318-13340 TACATTAAACAGAAACTGAAGGG + Intergenic
949625012 3:5855371-5855393 GATAAAAAACATAAATTGGCTGG - Intergenic
949688771 3:6609811-6609833 TAGAATAAAGAGGAAATGGATGG + Intergenic
949782486 3:7705604-7705626 ATTAATAAACACAAAATGGATGG + Intronic
950073054 3:10167709-10167731 TACAATAAAAAGAAACTGGCTGG - Intronic
950190762 3:10974645-10974667 TATAAGAAAACGAAAATGGAAGG + Intergenic
950537955 3:13592185-13592207 TTAAATAAACAAAAATTAGATGG - Intronic
950985431 3:17359063-17359085 TATAAAAATAAGAAATTTGAGGG + Intronic
951848914 3:27116754-27116776 TATAATGTACAGACGTTGGAAGG - Intronic
951990866 3:28675177-28675199 TGTTATAAACATAAATTAGATGG + Intergenic
952247491 3:31610253-31610275 TATAATAAAGCAAAATTGGTTGG + Intronic
952346408 3:32490980-32491002 TATAATTAACAAAAATTCTAAGG + Intronic
952428538 3:33200016-33200038 TATAATAAACAGAAACTTATTGG - Intronic
952713624 3:36455996-36456018 TATAATAAATAAACATAGGAAGG + Intronic
952723103 3:36554038-36554060 TATAATAAACAGAAATTTATTGG - Intergenic
953343112 3:42152252-42152274 TATAATAATAAGACATGGGAGGG + Intronic
953808463 3:46091876-46091898 TATAATGAACAGAAATTTATTGG + Intergenic
954165661 3:48755566-48755588 TATAATAAAAAGAGATTGGAAGG - Intronic
954349419 3:50030493-50030515 TAAAATAAACAGAAAGTTGTAGG - Intronic
955035072 3:55259827-55259849 TATAATAGAAAGAAAATGCAGGG + Intergenic
956137896 3:66117055-66117077 AATAAAAAATAAAAATTGGACGG - Intergenic
956321936 3:68007534-68007556 GATACTGAACAGAAAATGGAAGG - Intronic
956349427 3:68318356-68318378 CATTATATGCAGAAATTGGAAGG + Intronic
956585753 3:70862773-70862795 TATAAAATACAGAAGATGGAAGG - Intergenic
956664466 3:71629715-71629737 GACAATAAGCAGAAATTGCAAGG + Intergenic
956819992 3:72945564-72945586 TATGATGAAGAGAAAATGGAAGG + Intronic
957172395 3:76755077-76755099 TCTAATAAACATAAAATTGAGGG - Intronic
957615279 3:82518559-82518581 TATAAGAATAAGAAACTGGATGG - Intergenic
957832663 3:85543646-85543668 TATAACAAACAGAAATTTATAGG + Intronic
958686594 3:97406262-97406284 TATAATAAACAGAAATTTATTGG + Intronic
959091913 3:101911848-101911870 TTTAATAAACAGTTATTGGAGGG - Intergenic
959460708 3:106622481-106622503 TATAATCAACAGAAATTTATTGG + Intergenic
959713134 3:109404498-109404520 TAAAATAAATAAAAATTGGCCGG - Intergenic
959768391 3:110062018-110062040 TATAATAAACAAAAATCACAAGG - Intergenic
959822154 3:110748867-110748889 TAATATAAACAGTAATTGAAAGG + Intergenic
960090569 3:113634310-113634332 TTCTATAAATAGAAATTGGAAGG - Intergenic
961574217 3:127822079-127822101 TAAAATAAACACAGATGGGAAGG - Intronic
962160870 3:132998940-132998962 TATAATGAACAGAAATTTCTTGG - Intergenic
962662518 3:137617649-137617671 TGAAACAAACAGGAATTGGAAGG + Intergenic
962817256 3:139013011-139013033 TAAAATAAAAAGAAAGTGGAGGG - Intronic
963308080 3:143676293-143676315 TAGTATAAAGAGAAATTGGTAGG - Intronic
963405307 3:144855751-144855773 TTTCACAATCAGAAATTGGAGGG - Intergenic
963675274 3:148302986-148303008 TATAATGAACAAAAATAGTATGG + Intergenic
963822009 3:149907778-149907800 TGTAATAGACAAGAATTGGAAGG - Intronic
964928677 3:161988551-161988573 AATATTAAAGAGAAATTGGGAGG + Intergenic
965209744 3:165769360-165769382 TATTATCAACAAAAATAGGAAGG - Intergenic
965379577 3:167971492-167971514 TATAGTAAAAAGAACATGGATGG + Intergenic
965407813 3:168292642-168292664 TATTAAAAACAAAAAGTGGAAGG - Intergenic
965550094 3:169955801-169955823 TATAATGAACAGAAATTTATTGG + Intergenic
965718961 3:171640166-171640188 AATAAATAACAGAGATTGGAGGG - Intronic
965922591 3:173936322-173936344 TGTAATAAACATAAAATGCATGG - Intronic
967056470 3:185833295-185833317 TTTAAAAAACAAAAATTGGCAGG - Intergenic
967172345 3:186831520-186831542 TATAAACAACAGAAACTGGCCGG - Intergenic
967175455 3:186859582-186859604 TATAAAGAACAGAAATTTGTTGG - Intergenic
967483719 3:190005520-190005542 TTTCATAAACACAAAATGGAAGG - Intronic
967672190 3:192250192-192250214 CAGAATAAACAGAAATAGAAAGG - Intronic
968475829 4:807634-807656 AATAATAAAAAAAAATTGGCCGG - Intronic
968839854 4:2995269-2995291 TATAATAAAAAGAAATTTCTTGG + Intronic
970113308 4:12663202-12663224 TCTAATAAAAAGAAAATGAAGGG - Intergenic
970203771 4:13635192-13635214 TAGGAAAAGCAGAAATTGGAGGG + Intergenic
970385444 4:15551584-15551606 TGAAATATACAGTAATTGGAAGG - Intronic
970571629 4:17389040-17389062 TATAAGGAACAGAAATTTGTTGG - Intergenic
970848380 4:20571297-20571319 AATACTAAACAGAAAGTGCATGG + Intronic
971006125 4:22375797-22375819 TCTAAGAAACAGAAATTTTAGGG + Intronic
971487523 4:27175586-27175608 TGTAATCAACAAAAATTGGGAGG - Intergenic
971806582 4:31365998-31366020 TATAATAAACAGCTATTGAGGGG - Intergenic
971916086 4:32871668-32871690 TAAAATAAAGAATAATTGGAGGG + Intergenic
972063259 4:34908448-34908470 GATAGTAAACAGAAATAAGAAGG + Intergenic
972098645 4:35382758-35382780 TATAATAAACAGAAGTATGTTGG - Intergenic
972271435 4:37514008-37514030 TATAATGAACAGAAATTCATTGG + Intronic
972393830 4:38640060-38640082 TATACAAAACAGACAATGGAAGG - Intergenic
972405146 4:38738451-38738473 TAAAATAAAAATAAATTGGGTGG + Intergenic
972441785 4:39100930-39100952 TATACTAAACAGATATATGAAGG - Intronic
972993131 4:44846967-44846989 TATAATGAACAGAAATTTATTGG + Intergenic
973172975 4:47167890-47167912 TATAATAAACAGAAATTTACTGG - Intronic
973967274 4:56176420-56176442 AAAAAAAAAAAGAAATTGGAAGG - Intronic
974364537 4:60929202-60929224 TTTAAAACACAGAAATTGGCTGG + Intergenic
974551756 4:63383573-63383595 TATAATAAAAAAAAATTAGCTGG + Intergenic
974604800 4:64137387-64137409 TATCATAAATAAAATTTGGAAGG - Intergenic
974737502 4:65956253-65956275 TATAAGAAAAAGAAACTGAAAGG - Intergenic
974930568 4:68356715-68356737 TATAATGAACAGAAATTTATTGG - Intergenic
975076665 4:70217898-70217920 TATGATAAACAACAATTTGAAGG - Intergenic
975077793 4:70234315-70234337 TAAAACAAACAGAAACTGAAAGG - Intronic
975293998 4:72711265-72711287 TATAATGAAAAGTCATTGGATGG - Intergenic
975651062 4:76593694-76593716 TTTAATAAGCAGATCTTGGAAGG - Intronic
975652203 4:76604717-76604739 TATAGGAAACAGAAATAGCAGGG + Intronic
975921771 4:79398998-79399020 TATAATAAACAGAAATGTATTGG - Intergenic
976135228 4:81928951-81928973 ACTAACAAACAGAATTTGGAGGG - Intronic
976151130 4:82093145-82093167 TACAATAAAGAGAAATTTGAAGG - Intergenic
976222865 4:82772071-82772093 TATAATAAAAAAAATTTTGATGG + Intronic
976468093 4:85394580-85394602 TATAATAAACAGAAATTTATTGG + Intergenic
976834887 4:89360903-89360925 TATAAGAAAGCAAAATTGGAAGG - Intergenic
977713341 4:100152399-100152421 TAGAAAAAAAATAAATTGGAGGG - Intergenic
977827434 4:101550402-101550424 TATAATGAACAGAAATTGAATGG - Intronic
977858548 4:101926928-101926950 TAAAAGAAACAGTAATTAGATGG + Intronic
978470555 4:109062460-109062482 TGTAATAATCAGAAATAGAATGG + Intronic
978707521 4:111732137-111732159 GATTGTGAACAGAAATTGGAAGG + Intergenic
979035735 4:115714489-115714511 TATAATAAACAGAAATTTATTGG - Intergenic
979117730 4:116848908-116848930 TATAATACCCAGTAATGGGATGG + Intergenic
979554990 4:122035402-122035424 TTTCATAAACATAAATTGAATGG - Intergenic
979873200 4:125851995-125852017 TATAAAAAACAGAAAAAGGACGG - Intergenic
979953765 4:126928237-126928259 TATTATAAACACAAAGTGGGGGG + Intergenic
980078296 4:128317414-128317436 TATAATGAACAAAAATTTGTTGG - Intergenic
980121127 4:128729442-128729464 GCTAATAAACAGTAATTGGCAGG - Intergenic
980415022 4:132476200-132476222 CATAATTAACAGAAATTGCTGGG - Intergenic
980853015 4:138406171-138406193 TGTTATAAACAGAAATTAAATGG - Intergenic
980854453 4:138422970-138422992 AATATTAAAAAAAAATTGGATGG - Intergenic
980891682 4:138822254-138822276 TATAATAGACAGACATAGGAGGG - Intergenic
980945662 4:139318020-139318042 TATAATATTCAGAAAGTGGATGG + Intronic
980990895 4:139737447-139737469 TGGAATAAAAAGAAATGGGAAGG + Intronic
981130331 4:141151238-141151260 TATAAAAAACAAAACTTGGCTGG - Intronic
981728180 4:147869939-147869961 TATAATAAAGAGAAAATGCTGGG + Intronic
981815986 4:148830974-148830996 TAAAAGAAAAAGAAAATGGAGGG + Intergenic
981830338 4:148992537-148992559 TCTAATAAACACATATTTGATGG + Intergenic
981906263 4:149924742-149924764 TCTACTAAACAGAAATTGTGAGG + Intergenic
981953440 4:150440610-150440632 TATAAAAATCAGAAATCAGATGG + Intronic
982019352 4:151188142-151188164 TATAATGAACAGAAATTTATTGG - Intronic
982224768 4:153155402-153155424 AAGAATATGCAGAAATTGGAGGG + Intronic
982377834 4:154714158-154714180 TTTAATAAACAAGAATTAGAAGG + Intronic
982727982 4:158925830-158925852 TATAAGTAACAGAAATTTGGAGG + Intronic
983058059 4:163122867-163122889 TATAATGAACAGAAATTTATTGG - Intronic
983143655 4:164186187-164186209 TATTAAAACCAGAAATTGGCTGG - Intronic
983299312 4:165904870-165904892 CATCAAAAAGAGAAATTGGACGG + Intronic
983323570 4:166226021-166226043 TATAATAAACAGAAATTTATTGG + Intergenic
983459120 4:168005055-168005077 TATAATAAAATGAAATTAGTGGG - Intergenic
983497155 4:168455867-168455889 TTTAATACACATAAATTGGTGGG + Intronic
983572636 4:169226454-169226476 TATAATGAAGAAAAATTTGAGGG + Intronic
983587099 4:169367630-169367652 TATAATAAAAAGAAATGACAAGG + Intergenic
983702494 4:170615026-170615048 TATAATAAAAAGAAATTTATTGG + Intergenic
984184360 4:176524783-176524805 CATAGGAAACAGAAATTGGTAGG - Intergenic
984428227 4:179614961-179614983 TATAAAGAACAGAAGTTGGCTGG - Intergenic
985130558 4:186734623-186734645 TACAATGAACAGAAATTGCTTGG + Intergenic
985288214 4:188359116-188359138 TTTTATAAACAGAAATTATAAGG + Intergenic
985309117 4:188577815-188577837 TATATTAAAAATAAAATGGAAGG - Intergenic
986645178 5:9910299-9910321 TGTGATAAACAGAAGTAGGAAGG + Intergenic
987041868 5:14070458-14070480 TATAATGAACAGAAGTTGATTGG + Intergenic
987144739 5:14981236-14981258 TAAAATGAACAGAAGTAGGAAGG - Intergenic
987148070 5:15012110-15012132 TGTAATAAACAAAAATGGGGTGG + Intergenic
987597201 5:20017301-20017323 TCTTATAAATAGAATTTGGAAGG - Intronic
987657712 5:20828925-20828947 AAAAAAAAAAAGAAATTGGAAGG - Intergenic
987956167 5:24743503-24743525 TGTAATAAAGAGAAACTTGATGG - Intergenic
988020209 5:25611512-25611534 TCAATTAAACAGAAATTGGAAGG + Intergenic
988031622 5:25770670-25770692 TAGAAGAAACAGAAAGTTGAGGG + Intergenic
988814209 5:34816538-34816560 TATATTAAACAGATATTAAATGG - Intronic
989994712 5:50815334-50815356 CATAATAAATAGAAAATGCAAGG - Intronic
991146774 5:63316195-63316217 AATAATAAACAGGAGTTAGAAGG + Intergenic
991260366 5:64661351-64661373 TAGAGTAAAGAGAAAATGGAAGG - Intergenic
991510666 5:67373436-67373458 AATAAAAAAAAGAAAATGGAGGG + Intergenic
992011335 5:72530779-72530801 TATAATAAACAGAAATTGATTGG + Intergenic
992200513 5:74379301-74379323 TATTATAAACAGAAAGGGCAGGG + Intergenic
992203909 5:74411330-74411352 GAAAAGAAACAGAAAGTGGAAGG - Intergenic
992238556 5:74739004-74739026 TGTAATGGACAGAAAGTGGAAGG - Intronic
992356568 5:75990799-75990821 TATAATAAAAAAAAAGTGAAGGG + Intergenic
992585844 5:78238976-78238998 GATAATAAAAAGAAATGAGAAGG + Intronic
992603549 5:78431479-78431501 TGGAATAAACAGAAAATAGATGG - Intronic
992822295 5:80509492-80509514 TATAATAAACAGACATTTATTGG - Intronic
992825773 5:80548496-80548518 AATAATAAAAAGAAACTGGCAGG - Intergenic
992965201 5:81992362-81992384 TAAAATAAAAATAAAATGGATGG - Intronic
992990360 5:82277655-82277677 TATAATAAACTAAAACTTGACGG + Intronic
993536252 5:89090040-89090062 TATAATACACACTAAATGGAGGG - Intergenic
993547064 5:89225671-89225693 TATAAGAAAAGGAAATTGCAGGG - Intergenic
993572905 5:89564840-89564862 TAAACTAAACAGAAATTTCATGG - Intergenic
994030943 5:95142105-95142127 TATAATAAAAAGAAATAGTGGGG - Intronic
994313729 5:98307722-98307744 TATAGTAAACAGAAATTTATTGG - Intergenic
994390417 5:99185957-99185979 AATAATAAACAGAATCTGAATGG - Intergenic
994664453 5:102690960-102690982 TATCCTAAACAGAATTTGCATGG + Intergenic
994852269 5:105070926-105070948 TATATTAAACAAAAACAGGAAGG - Intergenic
994981608 5:106881454-106881476 TATAAAAGACAGAATTAGGAAGG - Intergenic
995036312 5:107538268-107538290 TATAAGAAAATGAATTTGGATGG - Intronic
995494881 5:112731320-112731342 TATAATGAACAGAAATTTATTGG + Intronic
995684878 5:114761501-114761523 TCTAATATCCAGAAATTGCAAGG - Intergenic
995779557 5:115761271-115761293 TATAATAAACAGAAATTTATTGG + Intergenic
995973721 5:118005328-118005350 TATAAAAAACATTACTTGGAAGG + Intergenic
996466240 5:123805793-123805815 TATAATAAACAGAAATTTATTGG - Intergenic
997393258 5:133534058-133534080 TATAATAAACAGAAAGTTATTGG + Intronic
997456637 5:134022345-134022367 TATAATAAACAGAAATTTATTGG + Intergenic
997957803 5:138293806-138293828 TAAAAAATACAGAAATTGGCTGG - Intronic
998272325 5:140718090-140718112 TAAAAAATACAGAAATTAGATGG + Intergenic
998420556 5:141981218-141981240 TATAATATATAGAAATTGAGAGG + Intronic
998609263 5:143670322-143670344 ACTAATAAACAGATATTTGAGGG + Intergenic
998756771 5:145390081-145390103 TACAATAAACAGAATTCTGATGG + Intergenic
998903997 5:146884207-146884229 TTTATTGTACAGAAATTGGAGGG - Intronic
999087455 5:148905286-148905308 TCTAAGAAACAGAAATTAAATGG - Intergenic
999139978 5:149354143-149354165 TTTAAAAACCAGAAAATGGAAGG - Exonic
999453390 5:151695151-151695173 TATAATAAACAGAAATTTAATGG + Intergenic
999807660 5:155098041-155098063 TCTAAAAAACAAAAAATGGATGG - Intergenic
1000219302 5:159197117-159197139 TATAATAAATGAACATTGGAAGG + Intronic
1000414591 5:160970202-160970224 AATATTTAAAAGAAATTGGAGGG - Intergenic
1000500224 5:162038805-162038827 CATAATAAACACAAATTTGTTGG - Intergenic
1000633785 5:163620512-163620534 TTTCATAAACAGTAATTTGAGGG - Intergenic
1001766154 5:174248833-174248855 TAAAAACAACAGAAATTGGCTGG + Intergenic
1002395776 5:178952830-178952852 TAAAATAAACAAAAATAGAAAGG - Intronic
1003440215 6:6133795-6133817 TAAATAAAACAGAGATTGGATGG - Intergenic
1003996882 6:11550467-11550489 TAAAAAAAAAAGAAATTGGCTGG - Intronic
1004315607 6:14584792-14584814 AAAAATAAATAGAAATTGGCTGG + Intergenic
1004464693 6:15873657-15873679 TATTCTAAACTGAAATTGTAAGG + Intergenic
1004643753 6:17539918-17539940 AAAAATAAACAGAAATTAGCTGG + Intronic
1004664491 6:17737032-17737054 CATATTAAACAGAAAGTGAATGG - Intergenic
1005191786 6:23232116-23232138 TAAAATAAAAATAAATTGTATGG - Intergenic
1005227111 6:23655867-23655889 AATATTAAACAGAGACTGGAGGG - Intergenic
1005318469 6:24627960-24627982 TAGAATAAGCAGTATTTGGAAGG - Intronic
1005526452 6:26655908-26655930 TATAATGAACAGAAATTTATTGG - Intronic
1006543552 6:34760368-34760390 GATAATACACAGAACTTGGCCGG - Intronic
1007441870 6:41868621-41868643 TATAAAAAACAGAAGTTGGCTGG - Intronic
1007942804 6:45798097-45798119 TATAATAAAAAAAAATTCAAAGG + Intergenic
1008175136 6:48259211-48259233 TAAAATAAAAAGAAATGGGTGGG - Intergenic
1008335659 6:50301773-50301795 CATAGTAAACAGAAATGGGATGG - Intergenic
1009485921 6:64221497-64221519 TATAATAAACAGAAATTTAATGG - Intronic
1009573762 6:65425000-65425022 TATAATGAATAAAAATTGAATGG + Intronic
1009617507 6:66029432-66029454 TATTATACTCAGAAACTGGAAGG - Intergenic
1010024084 6:71195830-71195852 GATAATAAAAAGAGATTGCAAGG + Intergenic
1010293187 6:74164070-74164092 TATAATTCACTGAAATTTGAGGG + Intergenic
1010365277 6:75043575-75043597 TATAATAAAAAAAAATTGAAAGG - Intergenic
1011040855 6:83029204-83029226 AATAATGAAGAGAAATTGAAAGG - Intronic
1011148990 6:84247980-84248002 TAAAATAAACCTGAATTGGATGG - Intergenic
1011153973 6:84308418-84308440 TATTTTAAATTGAAATTGGAGGG - Intergenic
1011187238 6:84691169-84691191 GATAATTTACAGAAATTGAAGGG - Intronic
1011267887 6:85543533-85543555 AATAATAAACAGAAAATAAATGG + Intronic
1011409805 6:87056260-87056282 TATAATAAACAGAAATGTATTGG + Intergenic
1011991289 6:93521217-93521239 TATAAGAAACAAAAAGTAGAAGG + Intergenic
1012000304 6:93646154-93646176 TTGAATTAAAAGAAATTGGATGG + Intergenic
1012188132 6:96247351-96247373 TATAACATAAAGCAATTGGAGGG + Intergenic
1012352371 6:98268473-98268495 TATAATGAACAGAAATTTATTGG + Intergenic
1012634941 6:101526319-101526341 TTTTAAAAATAGAAATTGGATGG + Intronic
1012774055 6:103480329-103480351 TATAATATCCAGAAGGTGGAGGG + Intergenic
1013132723 6:107250129-107250151 CATAAAAAACAGAAATTGAGAGG + Intronic
1013563158 6:111327126-111327148 TAGAATAACCAGAATTTGGTAGG - Intronic
1013672154 6:112416444-112416466 TATAGAATAGAGAAATTGGAAGG + Intergenic
1014274528 6:119372356-119372378 TATAAAAAGCAGCATTTGGAAGG + Intergenic
1014353077 6:120368123-120368145 TCTAATATACAGAATTTAGAAGG + Intergenic
1014707168 6:124761863-124761885 TGGAAAAAACAGAAATAGGAAGG + Intronic
1014771415 6:125461997-125462019 TATAATAAACAGAAATTTATTGG + Intergenic
1014872859 6:126617634-126617656 TACCATAAACAGAAATTGTTAGG - Intergenic
1015255425 6:131174108-131174130 TATAAAAAATAGAAGCTGGAGGG + Intronic
1015361568 6:132345518-132345540 TATTATAGACAGATAATGGATGG - Intronic
1015462700 6:133511037-133511059 TATAATTTACAGAAATTACAGGG - Intronic
1015869043 6:137757221-137757243 TATAATAAACTGATTTTGGTTGG + Intergenic
1016180786 6:141145699-141145721 TATCATAAGAAGAAATTGGTTGG + Intergenic
1016286445 6:142478401-142478423 TATAAACAACAGAAATTTAATGG - Intergenic
1016721186 6:147300539-147300561 TACAAAGAACAAAAATTGGAAGG + Intronic
1016766000 6:147795055-147795077 AATAATAAAAAAAAATAGGATGG - Intergenic
1016914437 6:149232035-149232057 GATCAGAAACAGAAATTTGAGGG + Intronic
1017309753 6:152960998-152961020 TATAATGAACAGAAATTTATTGG - Intergenic
1017558436 6:155600219-155600241 TATAATTAAAAGACTTTGGAAGG + Intergenic
1017952331 6:159146522-159146544 TATAATAAACAGAAATTAATTGG + Intergenic
1018658393 6:166062676-166062698 TATAATGAACAGAAATTTATTGG + Intergenic
1020605334 7:10330381-10330403 TATGATAAACTGAGATTGGAAGG + Intergenic
1020612024 7:10410014-10410036 TATAAAAAACAAAAATGAGACGG - Intergenic
1020681198 7:11238881-11238903 AATAAAAAACAGAAATTCGCTGG - Intergenic
1020898446 7:13972268-13972290 TATAAAATACAAAAATTGGCCGG + Intronic
1021282959 7:18742832-18742854 TATGATAAACAGGGATTGCAAGG - Intronic
1021339429 7:19445425-19445447 TACAAAAAATAAAAATTGGAGGG + Intergenic
1021833156 7:24638625-24638647 TAGAAAATACAGAAATTGGCCGG - Intronic
1022381773 7:29867105-29867127 AATAATAAAAAGAAATGGGAAGG - Intronic
1022553560 7:31267924-31267946 TAGATTAAAAAGAAATTTGAAGG - Intergenic
1023250314 7:38253275-38253297 TAGAAAAAAGAGGAATTGGATGG - Intergenic
1023251622 7:38269386-38269408 TAGAAAAAAGAGGAATTGGATGG - Intergenic
1023320393 7:38991023-38991045 TATAAGAAATAGAGATTTGAAGG + Intronic
1023498497 7:40823573-40823595 TATTATAAACAGTAGTTGGAAGG + Intronic
1024493272 7:50011520-50011542 TATAATTAACTAAAAGTGGATGG - Intronic
1024514685 7:50235820-50235842 TACAATAAACATCAACTGGATGG - Intergenic
1024807183 7:53156616-53156638 TACATTAAACAGAAACTGAAGGG + Intergenic
1025319505 7:58079577-58079599 TACATTAAACAGAAACTGAAGGG - Intergenic
1025483336 7:61014310-61014332 TACATTAAACAGAAACTGAAGGG - Intergenic
1025489164 7:61090474-61090496 TACATTAAACAGAAACTGAAGGG + Intergenic
1025554211 7:62283898-62283920 TACATTAAACAGAAACTGAAGGG + Intergenic
1025560570 7:62369376-62369398 TACATTAAACAGAAACTGAAGGG - Intergenic
1025564657 7:62418681-62418703 TACATTAAACAGAAACTGAAGGG - Intergenic
1025872171 7:65445001-65445023 TATAATAAAAAAAAAATGGGAGG + Intergenic
1026352004 7:69525743-69525765 TATAACAAATGAAAATTGGAGGG - Intergenic
1026931833 7:74227201-74227223 TAAAATAAATACAAATTGGCCGG - Intronic
1027306854 7:76907528-76907550 TATAATAAAAAGAAATAGGATGG - Intergenic
1027869931 7:83694116-83694138 CAAAATACACAGAAATTGGAGGG + Intergenic
1027883804 7:83876575-83876597 TATAATAAAAAGGAACTGGCTGG + Intergenic
1028895075 7:96031850-96031872 TGTATTAAACACAAAATGGAAGG - Intronic
1028951000 7:96634890-96634912 TATAATAAAGAAATAATGGAAGG + Intronic
1029378216 7:100195204-100195226 TATAATAAACAGGAAGTAGGTGG + Intronic
1030020767 7:105273245-105273267 TATAAAAAAGAGAGAATGGAGGG - Intronic
1030169933 7:106590896-106590918 TATAAAGAACAGAAATTGGCCGG + Intergenic
1030906229 7:115186807-115186829 TATAATAAACAGAAATTTATTGG + Intergenic
1031216957 7:118906450-118906472 AATAATAAACATTAGTTGGAGGG - Intergenic
1031316342 7:120262118-120262140 TATAACAAACAGGAAGTAGAAGG - Intergenic
1031384339 7:121128842-121128864 TATAATAAGCAGAAATAACAAGG - Intronic
1031501474 7:122523074-122523096 TTTAATAAACAGACATTAGTGGG + Intronic
1031694067 7:124827268-124827290 CATAACAAACACATATTGGAGGG + Exonic
1032509732 7:132463179-132463201 TATAAAAAATAAAAATTGTAGGG + Intronic
1032891709 7:136201690-136201712 TATCATAACAAGAAATTAGAAGG - Intergenic
1033037586 7:137889126-137889148 GATATCAACCAGAAATTGGAAGG - Intronic
1033093324 7:138406792-138406814 TATAATACACAGAAATTTATTGG - Intergenic
1033163755 7:139020313-139020335 AAAAATAATCAGAAATTGGCTGG + Intergenic
1033376881 7:140770132-140770154 AATAATAATCAGAAAATGCAAGG - Intronic
1033985296 7:147218984-147219006 TATAATAAACAGAAATGTATTGG + Intronic
1034183346 7:149155635-149155657 TGTAATGAGGAGAAATTGGAGGG + Intronic
1034314063 7:150113277-150113299 TATAATTTACAGAAGTGGGAAGG - Intergenic
1035147449 7:156834302-156834324 TGTTACAAACAGAAATTGGCTGG + Intronic
1035469785 7:159102405-159102427 TATAAGAAACAGAGCTTTGATGG - Intronic
1035868975 8:3116173-3116195 GATATTAAACACACATTGGATGG + Intronic
1036121864 8:6027009-6027031 TATAATTAACAGAAATTTATTGG + Intergenic
1036122392 8:6032659-6032681 TATAATGAACAGAAATTTATTGG + Intergenic
1037181348 8:16009832-16009854 TATAATAAACAGTAGTTAGAAGG + Intergenic
1037365823 8:18121500-18121522 TCCAAAAGACAGAAATTGGAAGG + Intergenic
1037477832 8:19274968-19274990 TATAATAATGAAAAACTGGAAGG + Intergenic
1038077801 8:24097232-24097254 TGTATTAAACACAAATTGGTAGG + Intergenic
1038462031 8:27725461-27725483 TATAGTAAAAAGAAATTTTAAGG + Intergenic
1038600309 8:28934627-28934649 AATAATATACAGAAATTGGCCGG + Intronic
1038680065 8:29658553-29658575 AATAATAAACAGAAATAGGCAGG - Intergenic
1038922830 8:32103890-32103912 TATAATCAACAGATAAAGGAGGG - Intronic
1039110510 8:34036376-34036398 TATAATAAAAAAAAAAAGGAAGG - Intergenic
1039813959 8:41075744-41075766 TTTGATAAAAAGAAAATGGAAGG + Intergenic
1040016632 8:42705619-42705641 TATAATGAACAGAAATTTATTGG - Intronic
1040820843 8:51555093-51555115 CATAATGAACAGAAATTCGTTGG + Intronic
1040987314 8:53309993-53310015 TATAATAAATATAAATCTGATGG - Intergenic
1041823938 8:62069805-62069827 AATATCAAACAGAAATTAGAAGG + Intergenic
1041892998 8:62892216-62892238 AATAATAAACAGAAATAAAAAGG + Intronic
1042039787 8:64579157-64579179 TATAAGAAAGAGTTATTGGAAGG + Intergenic
1042387233 8:68190870-68190892 GATACTAAACAGAAATTTTAAGG - Intronic
1042496443 8:69459305-69459327 TTTTATAAACAGGAATTAGAGGG + Intergenic
1042684184 8:71419109-71419131 TAAAATAAAGAAATATTGGAGGG + Intronic
1042802860 8:72739446-72739468 TACAATAGAAACAAATTGGAGGG + Intronic
1043021670 8:75009383-75009405 TCTAATAAACAGAAAGAGGCTGG - Intronic
1043357433 8:79429390-79429412 TATAATGAACAGAAATTTATTGG - Intergenic
1043551302 8:81376023-81376045 TTTAATAAACAGATAATGGAGGG - Intergenic
1043624458 8:82238807-82238829 TATGAAAAACAGCAATTAGAGGG + Intergenic
1043624761 8:82243054-82243076 TATAATGAACAGAAATTTATTGG - Intergenic
1043953126 8:86331542-86331564 TATAATGAACAGAAATTTATTGG + Intergenic
1044361493 8:91290000-91290022 TATAATCATTAGAATTTGGAAGG - Intronic
1044657805 8:94566384-94566406 TATAACAAACAGAAATTTATTGG - Intergenic
1044810932 8:96061211-96061233 TTAAATAAACATAAATTGCATGG + Intergenic
1044862555 8:96537008-96537030 TATAATATAGATAAATTGAATGG - Intronic
1044922979 8:97185481-97185503 TTTAACAAACAGAAGTTGGCAGG - Intergenic
1045517216 8:102870426-102870448 TATAATGCACAGAAATTTGTTGG - Intronic
1045895439 8:107210345-107210367 TATTATAAAAAGAAAATGCATGG + Intergenic
1046035166 8:108832038-108832060 TATAATCAAGAGAAATTGTGAGG - Intergenic
1046468824 8:114641273-114641295 TATAATCAAATAAAATTGGAAGG - Intergenic
1046571815 8:115975713-115975735 TATAATAAACAGAAACTTATTGG + Intergenic
1047030633 8:120875592-120875614 TATAATAAGAAAAAATTGGCGGG - Intergenic
1048193694 8:132313590-132313612 TCTAGTAAACTGAAAATGGAAGG + Intronic
1048264783 8:132976210-132976232 TATAATAAACAGAAATGTATTGG + Intronic
1048584358 8:135758915-135758937 TATAATAAACAGAAATGTGGGGG - Intergenic
1048690549 8:136957748-136957770 TCTAATAAACATAAATTGTCAGG + Intergenic
1050464633 9:5909022-5909044 TCAAGTAAAGAGAAATTGGATGG - Exonic
1050506428 9:6353731-6353753 TATAAAAAACAAAAATTAGCTGG + Intergenic
1051051435 9:12936977-12936999 TATAATACACAGAAAGAGGATGG - Intergenic
1051282427 9:15455636-15455658 TGTAATAAACATAAGATGGAAGG + Intronic
1051396363 9:16626055-16626077 TAAAAGAAACACAACTTGGAGGG + Intronic
1051602053 9:18885153-18885175 TATAATGAACAGAAATTTAGTGG + Intronic
1051741889 9:20260308-20260330 CATAATAAACAGAAATTTATTGG - Intergenic
1051803178 9:20960581-20960603 TATAATAAAAAAAAAATAGATGG - Intronic
1052035607 9:23676932-23676954 TATAATGAACAGAAATTTATTGG - Intergenic
1052264343 9:26553827-26553849 TTTAAACAACAGAAATTGGCCGG - Intergenic
1052404859 9:28046623-28046645 TATAATGAACAGAAATTTCAAGG - Intronic
1052649954 9:31290284-31290306 TACTCTAAACAGAACTTGGAGGG + Intergenic
1052657457 9:31381101-31381123 TATAAAGAAAAGAAAATGGATGG - Intergenic
1052783070 9:32800977-32800999 TATAATGAACAGAAATTTATTGG - Intergenic
1053604077 9:39639426-39639448 TATAATAAACAGAAATTTATTGG - Intergenic
1053861152 9:42387320-42387342 TATAAAAAACACAAATTGGCCGG - Intergenic
1053861892 9:42395478-42395500 TATAATAAATAGAAATTTATTGG - Intergenic
1054249463 9:62702988-62703010 TATAATAAACAGAAATTTATTGG + Intergenic
1054442734 9:65282328-65282350 TACATTAAACAGAAACTGAAGGG + Exonic
1054487543 9:65739173-65739195 TACATTAAACAGAAACTGAAGGG - Intergenic
1054563574 9:66737520-66737542 TATAATAAACAGAAATTTATTGG + Intergenic
1055023463 9:71694417-71694439 TATAAACAACAGAAATTGGCTGG - Intronic
1055136386 9:72834014-72834036 AAAAAAAAACAGAAAATGGATGG - Intronic
1055160756 9:73124858-73124880 TATAATGAACAGAATTTGTTTGG - Intergenic
1055450139 9:76423486-76423508 TATAATAAACAGAAATTTATTGG - Intronic
1055545722 9:77371296-77371318 TATAATGAACAGAAATTTATTGG + Intronic
1056281584 9:85046180-85046202 TATAATAAACAGATACAGGTGGG - Intergenic
1056722740 9:89085662-89085684 TGAATTAAACAGAAACTGGATGG - Intronic
1057145047 9:92752798-92752820 TATAATAAACAAGAGTGGGAGGG + Intronic
1057510234 9:95672473-95672495 TATATTAAAAAAAAACTGGAGGG + Intergenic
1057615701 9:96587880-96587902 TATAATAATGAGAAATTGTGGGG - Intronic
1058230078 9:102415002-102415024 TAGAAAGAACAGAAATTGGCTGG + Intergenic
1058271491 9:102977004-102977026 TATAATGAACAGAAATTTACTGG + Intergenic
1058294535 9:103288962-103288984 TAAAATAAACAACAATTGCATGG + Intergenic
1058299339 9:103351164-103351186 TATAATAGCCAAAAAATGGAAGG + Intergenic
1059052317 9:110939330-110939352 TATAGGAAACAGAAATTAAATGG - Intronic
1060356221 9:122910689-122910711 TATAAGAAACAAAGATTGGGGGG + Exonic
1060385508 9:123223808-123223830 TATAATTAACAGAAATTACAGGG + Intronic
1061186191 9:129055372-129055394 TAAAATATACACAAATTGGCTGG - Intronic
1061642982 9:131974202-131974224 TATTATAAAAAGAAATTCCAAGG - Intronic
1203614706 Un_KI270749v1:48949-48971 TACATTAAACAGAAACTGAAGGG - Intergenic
1185665412 X:1761539-1761561 AACAAAAAACAGAAATTGGCTGG - Intergenic
1185786469 X:2895472-2895494 TAAAATATACAAAAATTAGATGG + Intergenic
1186539549 X:10386532-10386554 GAGAATAAAAAGAGATTGGAGGG + Intergenic
1186567089 X:10674832-10674854 AATAAAAAACTGAAATTGAAAGG + Intronic
1187101800 X:16200410-16200432 TAGAATTAAAAGAAATTGGAAGG - Intergenic
1187261436 X:17688099-17688121 GATAATAAAGAGAAATTAAAAGG + Intronic
1188143441 X:26581059-26581081 AATAATAAAAATAAAATGGAGGG - Intergenic
1188677681 X:32963216-32963238 TATTAGACACAAAAATTGGAAGG + Intronic
1188790052 X:34396919-34396941 CATAATAAACAAAGATTAGATGG - Intergenic
1188906369 X:35796976-35796998 TAGAGTACACAGAAATCGGAGGG + Intergenic
1188950049 X:36360007-36360029 TAAAATAAAGAGATATTGGGAGG - Intronic
1189451839 X:41141527-41141549 TAAAGTAAACTGAAATTGGGAGG + Intronic
1189621502 X:42845465-42845487 TATAATGAACTGAAATTGTAAGG - Intergenic
1189635045 X:42998499-42998521 TATAATACATAGAAAATAGAAGG + Intergenic
1190466869 X:50733594-50733616 TATAATAAACAGAAATTTATTGG - Intronic
1190913532 X:54793118-54793140 TTAAAAAAAAAGAAATTGGATGG - Intronic
1191111450 X:56805817-56805839 TATAATAAAAAAAAAGTGAAGGG - Intergenic
1191600971 X:63006177-63006199 TACAATAAACATATATTGTATGG - Intergenic
1191929367 X:66352237-66352259 TATAATCTACAAAAATGGGATGG - Intergenic
1192386607 X:70678355-70678377 TATAATACACAAAGATTAGAAGG + Intronic
1193008505 X:76648059-76648081 TATAATAAACAGAAATTTATTGG + Intergenic
1193080734 X:77403767-77403789 TTTAATAAACAGAAATTTACTGG + Intergenic
1193189662 X:78554720-78554742 TCCAATAATCAGAAATTGTAAGG + Intergenic
1193548667 X:82861456-82861478 TATAATAAACAGAAATTTACTGG - Intergenic
1193765591 X:85525654-85525676 TCTAATAAAAAGAAATTGAGTGG - Intergenic
1193902291 X:87196156-87196178 TATAATGAACAGAAATTTGTTGG - Intergenic
1193961564 X:87931666-87931688 TATAATCAACAGACTTTGAAAGG - Intergenic
1194564094 X:95461567-95461589 TATTATTAACAGAAAATAGATGG + Intergenic
1194878303 X:99218295-99218317 TATAAGAAATAGAAATTTGTTGG + Intergenic
1195477139 X:105300127-105300149 TATAATAAAAAGAATTTGTAAGG + Intronic
1195488150 X:105434591-105434613 TCTAATATCCAGAATTTGGAAGG - Intronic
1195798206 X:108677159-108677181 TAAATTAAACAGAAACTGTAGGG - Intronic
1196328675 X:114440585-114440607 TATAATGAACAGAAATCTGTTGG + Intergenic
1196504036 X:116419463-116419485 TATAATGAACAGAAATTTATTGG + Intergenic
1196522550 X:116691379-116691401 TGTAAAAAACAGAAATTATATGG + Intergenic
1196960476 X:120994635-120994657 TACAATAAACAGAAATTTATTGG - Intergenic
1197312054 X:124916900-124916922 TATAATGAACAGAAATTTATTGG - Intronic
1197324275 X:125072723-125072745 AATAAAAAAAAGAAATTGCAAGG + Intergenic
1197344076 X:125310809-125310831 TAAAATAAACAGAAAAAGAATGG + Intergenic
1197349153 X:125360698-125360720 TATAACAAACAGAAATTTATTGG - Intergenic
1198834446 X:140787428-140787450 TATAATACAAGAAAATTGGAAGG - Intergenic
1198859697 X:141056001-141056023 TATAAGAACCAAAAATTAGATGG - Intergenic
1198902996 X:141531389-141531411 TATAAGAACCAAAAATTAGATGG + Intergenic
1198955958 X:142130790-142130812 TCTAATAAGAAGAAATGGGATGG - Intergenic
1199062070 X:143368755-143368777 TATAATAAAAAAAAATTTGTTGG + Intergenic
1199526481 X:148798020-148798042 TATAATGAACAGAAATTTATTGG + Intronic
1200978718 Y:9241206-9241228 TATAAAAAAGAGAAATTTTAAGG - Intergenic
1201213604 Y:11702779-11702801 TCTAATAAACAGGAATTGAATGG + Intergenic
1201628111 Y:16037861-16037883 TAAAATAAACAGAAAAAGAATGG + Intergenic
1202025200 Y:20514623-20514645 CAAAATAAATAGAAAGTGGATGG - Intergenic