ID: 1118547346

View in Genome Browser
Species Human (GRCh38)
Location 14:66906183-66906205
Sequence GTTCAGCAGTACCACGCTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 2, 1: 5, 2: 19, 3: 63, 4: 114}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118547346_1118547348 5 Left 1118547346 14:66906183-66906205 CCTACAGCGTGGTACTGCTGAAC 0: 2
1: 5
2: 19
3: 63
4: 114
Right 1118547348 14:66906211-66906233 TCATGATTTAGCATCTCCTTTGG 0: 1
1: 0
2: 3
3: 24
4: 225

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118547346 Original CRISPR GTTCAGCAGTACCACGCTGT AGG (reversed) Intronic