ID: 1118547346

View in Genome Browser
Species Human (GRCh38)
Location 14:66906183-66906205
Sequence GTTCAGCAGTACCACGCTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 2, 1: 5, 2: 19, 3: 63, 4: 114}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118547346_1118547348 5 Left 1118547346 14:66906183-66906205 CCTACAGCGTGGTACTGCTGAAC 0: 2
1: 5
2: 19
3: 63
4: 114
Right 1118547348 14:66906211-66906233 TCATGATTTAGCATCTCCTTTGG 0: 1
1: 0
2: 3
3: 24
4: 225

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118547346 Original CRISPR GTTCAGCAGTACCACGCTGT AGG (reversed) Intronic
900622346 1:3593217-3593239 GTTCAGCCGCTCCCCGCTGTGGG - Intronic
904275289 1:29379820-29379842 ATTAAGCAGCACCATGCTGTAGG - Intergenic
904426565 1:30427628-30427650 GTTCAGCAGCACCACATTGTAGG + Intergenic
912640665 1:111342537-111342559 GTTCAGCAGTGCAAAGCTGTAGG - Intergenic
912731344 1:112109053-112109075 GTTGAGCAGCACCATGCAGTAGG - Intergenic
915801430 1:158797070-158797092 GTTCAGTAGAACCTCACTGTAGG - Intergenic
915880371 1:159664796-159664818 GTTCAGCAGCACCATGCAGTAGG - Intergenic
916143840 1:161722980-161723002 GTTCTGCAGTTCCAAGCAGTGGG + Exonic
916468373 1:165094930-165094952 GTTCAGCAGCACCACAGCGTAGG + Intergenic
918229868 1:182518431-182518453 GTTCAGCAACATCACACTGTAGG - Intronic
918621033 1:186606102-186606124 GTTCAGCAGCACCGGGCTCTAGG - Intergenic
918969559 1:191396971-191396993 TTTCAGCAGCACCCCGCTCTTGG - Intergenic
920930855 1:210386597-210386619 GTTCAGCACTACCAGGATGGAGG - Intronic
921942195 1:220853730-220853752 GTTCAGCAGCACCATGCTGTAGG - Intergenic
922136385 1:222831507-222831529 ATTCAGCAGTTCTAAGCTGTAGG - Intergenic
923937656 1:238781381-238781403 GTTCAGCACCATCATGCTGTAGG - Intergenic
1065496570 10:26335410-26335432 GTTTGGCAGCACCATGCTGTAGG - Intergenic
1067079649 10:43205817-43205839 GTCCAGCTCTACCACTCTGTGGG + Intronic
1069804693 10:71112980-71113002 GTTCAGCAGCACCATGCTGTAGG - Intergenic
1070040357 10:72772204-72772226 GTTCAGCAGCACCATGCTGTAGG + Intronic
1070584859 10:77756487-77756509 GTTCAGTAGCACCACACTGTAGG + Intergenic
1072772096 10:98150713-98150735 GTTCAGCAGCACCACGCTGTAGG - Intronic
1075206860 10:120456449-120456471 GTTCAGCAGCCCCAAGCTGCTGG + Intergenic
1076926329 10:133490001-133490023 GTTCAGCAGCACCATGCTGTAGG - Intergenic
1078636933 11:13060196-13060218 GTGCAGCAGTGCCACGATCTTGG - Intergenic
1080192481 11:29568804-29568826 GTTCAGCAGCACTATGCTGTGGG + Intergenic
1080716995 11:34812505-34812527 GTTCAGCAGCACCATACTGTAGG + Intergenic
1081040292 11:38201496-38201518 ATTCAGCAGCATCATGCTGTAGG + Intergenic
1082935428 11:58652094-58652116 GCTCAGCAGCACCATGCTATAGG - Intronic
1086035960 11:82414702-82414724 TTTTAGCAGCACCATGCTGTAGG + Intergenic
1092865709 12:12759034-12759056 GTCCAGCTGAACCACACTGTAGG - Intronic
1092941391 12:13410465-13410487 GTTTAGCAGCACCATGCTGTAGG + Intergenic
1093142663 12:15527549-15527571 GTTCAGCAGCACCATACTGTAGG + Intronic
1094471694 12:30807462-30807484 CTTCAGCAGCACCATGCTGTAGG + Intergenic
1095777632 12:46026740-46026762 GTTCAGCAGCACCATGCTGTAGG - Intergenic
1097646236 12:62237908-62237930 GTTCAGCAACACCAAGATGTAGG - Intronic
1099434551 12:82627897-82627919 GTTCAGCAGCACCGCACTGTAGG + Intergenic
1101364359 12:104058000-104058022 GTTCAGCAGCACCACACTGTAGG - Intronic
1103502921 12:121418640-121418662 GTTCAGGAGTACGAGGCTGCAGG + Intronic
1105968388 13:25405118-25405140 GTTCAGCAGCAAGAGGCTGTTGG + Intronic
1105981963 13:25526677-25526699 GCTTAGCAGCACCATGCTGTAGG - Intronic
1106859770 13:33893162-33893184 GTTCAGCAGCACCACACCATTGG + Intronic
1106904881 13:34395402-34395424 GTTCAGCAGCACCACTCTACAGG + Intergenic
1108560959 13:51643536-51643558 GTTCATCAATACCACCCTGTAGG - Intronic
1108769413 13:53680266-53680288 GTTCAGCAGTACCATGCTGTAGG - Intergenic
1109362711 13:61316845-61316867 GTTCAGCAGCACCATGTGGTAGG - Intergenic
1112040115 13:95538753-95538775 GTACAGCAGGACAACGGTGTTGG - Intronic
1112480037 13:99766869-99766891 GTTTAGCAGTACCACACTATAGG - Intronic
1115279675 14:31647575-31647597 GTTCAGCAGCACCACATTGTAGG - Intronic
1116745597 14:48814591-48814613 GTTCAGCAGCACTATGCTGCAGG + Intergenic
1117618067 14:57554473-57554495 GTTCAGCAGCTCCAAGCTATAGG - Intergenic
1118547346 14:66906183-66906205 GTTCAGCAGTACCACGCTGTAGG - Intronic
1126815858 15:52452561-52452583 GTTCAGCAGTATCATACTGTAGG + Intronic
1127188079 15:56500851-56500873 GTTCAGCAGCATCGTGCTGTAGG + Intergenic
1127739844 15:61892261-61892283 GTTCAGCAGCACAACACTGTGGG + Intronic
1130172966 15:81535717-81535739 GTTCAGCAGCTCCAGGCTGTAGG + Intergenic
1139047175 16:63076056-63076078 GTTCAGCAGCACCACAGTGTAGG - Intergenic
1143732879 17:8890894-8890916 GTTCAGCAGCAGCACGGTGCTGG + Exonic
1148403438 17:47388031-47388053 GTTCAGCAGTACCACACTGTAGG - Intronic
1149636273 17:58172488-58172510 GTCCAGCAGCACCATGCTGTAGG + Intergenic
1149949355 17:60968732-60968754 GTTCAGCAGCACCATGTAGTAGG - Intronic
1150325931 17:64257591-64257613 GTCCAGCAGATCCACGCCGTAGG + Intronic
1151756690 17:76079306-76079328 GTTCAGCATTACCTTGCTGTTGG + Exonic
1153722606 18:7922248-7922270 GTTAAGCAGCACCTCACTGTAGG - Intronic
1155113702 18:22742621-22742643 GTTCAGCAGCACCACACTGTAGG + Intergenic
1155978007 18:32152761-32152783 GTTCAGCAGCACCACACTGTAGG - Intronic
1157813134 18:50711901-50711923 GATCACCAGTACCATGTTGTGGG + Intronic
1157917472 18:51680319-51680341 GTTCAGCACCACCAGGCTGTAGG + Intergenic
1159705663 18:71683378-71683400 GTCCAGTAGTTCCATGCTGTAGG + Intergenic
1159837209 18:73352708-73352730 GTTCAGCAGCAACACTCTGCAGG - Intergenic
1162265753 19:9572560-9572582 GTTCAGGAGCACCATACTGTAGG + Intronic
1165461119 19:35944955-35944977 GTCCAGCTGGACCACGGTGTGGG - Exonic
1165566185 19:36730293-36730315 GTTCAGCAGCAGCATGCTGTAGG + Intronic
925418675 2:3692707-3692729 GTTCAGCAACACCATGTTGTAGG - Intronic
926610848 2:14945083-14945105 GTTCAGCAGCACCAAGCTGCCGG + Intergenic
926875397 2:17471139-17471161 GTTCAGCAGCACAATGCTGTAGG - Intergenic
927523830 2:23719904-23719926 GTTAAGCAGCGCCATGCTGTAGG + Intergenic
929523208 2:42674302-42674324 GTTAAGCAGAACCACACTATGGG - Intronic
930858753 2:56047228-56047250 GTTCAGCAGCACCTTGCTGGTGG + Intergenic
931542067 2:63340350-63340372 ATTCAGCAGCACCACACTTTAGG - Intronic
932609056 2:73185187-73185209 GTTCAGCAGCACCATCCTCTTGG - Intergenic
933460214 2:82573659-82573681 ATTCAGCTGTACCATGCTGTAGG - Intergenic
934782199 2:96977917-96977939 GTTCAGCAGTTCATCGCTGGAGG + Intronic
939080410 2:137654297-137654319 GTTCAGCAGTACCACGCTGTAGG - Intronic
939847586 2:147267534-147267556 ATTCAGCAGCACCACACTGTAGG - Intergenic
940532013 2:154889850-154889872 GTTCGGCAGCACCACATTGTAGG - Intergenic
941360610 2:164546856-164546878 GTTCAGCAGCACCACACGATAGG + Intronic
941477870 2:165970774-165970796 GCTCACCAGCACCATGCTGTAGG + Intergenic
941862198 2:170294818-170294840 GTTCAGTTGTACCACTCTGGTGG + Intronic
943102479 2:183505172-183505194 GTTCAGCAGCATCATGCTGTTGG - Intergenic
945676680 2:212863470-212863492 GTTCAGCAGCATCACCCTGTAGG - Intergenic
946926171 2:224629444-224629466 GTTCACCAGGAACACGATGTGGG - Intergenic
947305386 2:228740634-228740656 GTACAGCAGCACCATGCTCTAGG - Intergenic
948739962 2:240039849-240039871 GTTCAGCAGCACCATGCTGTAGG - Intergenic
1170863492 20:20130774-20130796 GTTCAGCAGCACCACACTGTAGG - Intronic
1171508347 20:25658171-25658193 GTTCACCAGCACCATGCTGTAGG - Intergenic
1178359871 21:31939854-31939876 GTTAAGCAGAACCAGGGTGTGGG - Intronic
1179451075 21:41468835-41468857 GTTCAGCAGAACCAAGCCGTTGG - Intronic
1180575980 22:16774916-16774938 GTGCAGCAGTACCATGAGGTAGG - Intergenic
1181651640 22:24262172-24262194 GGTCAGCACTGCCATGCTGTGGG - Intergenic
1184150628 22:42636332-42636354 GTCCAGTAGTACCAGGCTGTGGG + Intronic
1184327470 22:43800124-43800146 TTTCAGCAGTCACATGCTGTAGG + Intronic
949665161 3:6330836-6330858 TTTCAGCAGTACCCCACTGCTGG - Intergenic
952972684 3:38662633-38662655 GTTCAGCAGCAACACACTGTAGG + Intergenic
954946997 3:54434641-54434663 GCTCAGCAGTAGCAGGCTGGTGG + Intronic
955267832 3:57464298-57464320 ATTCTGCAGCACCACACTGTAGG + Intronic
955395226 3:58552470-58552492 GTTCAGCAGCACCATGCTGTAGG - Intergenic
957655641 3:83070537-83070559 GTTTACCAGTACCACACTGTAGG + Intergenic
959679826 3:109082040-109082062 GTTCAGCAGCATCACACTGCAGG + Intronic
960749171 3:120927326-120927348 GTTCAGCAGTATCATGCTATAGG - Intronic
962497928 3:135961580-135961602 GTTCAGCAGCAACATGATGTAGG - Intergenic
962763309 3:138538286-138538308 GTTCAGCAGCACCACACTGTAGG + Intronic
964803543 3:160581213-160581235 GCTCAGCAGCAACATGCTGTAGG + Intergenic
965884629 3:173429869-173429891 GTTCAGCAGCAACATGCTTTAGG - Intronic
968205341 3:196794734-196794756 GTTCAGCAACACCATGTTGTAGG + Intronic
969473823 4:7409399-7409421 GTTCAGCAGCACCATGCTGTTGG - Intronic
970866938 4:20770095-20770117 GTTCAGAAGAAGCAGGCTGTGGG - Intronic
971471658 4:27033042-27033064 ATTCAGCTTTACCACGCTGCTGG - Intergenic
971797346 4:31244696-31244718 ATTCAGCAGCACCACACTGTAGG + Intergenic
976833890 4:89348173-89348195 GTTCAGCAGTATCATGCTGTAGG - Intergenic
978888217 4:113791234-113791256 GTTCAGCAGCCCTATGCTGTAGG + Intergenic
979380796 4:120004189-120004211 GTTCAGCAGCACCACATTATAGG + Intergenic
980066209 4:128191628-128191650 GTTCAGCAGGACCACACTGTAGG - Intronic
980868045 4:138576758-138576780 ATTCAGCAGCACCATGCTGTAGG + Intergenic
980955652 4:139426953-139426975 GGTCAGCAGGTCCACGATGTAGG + Intergenic
981159554 4:141481723-141481745 GTTCAGCAGCAGTATGCTGTAGG - Intergenic
981900692 4:149858378-149858400 ATTCAGCAGCACCATGCTGTAGG + Intergenic
983655622 4:170080587-170080609 GTTCAGCAGCACCACACTGCAGG + Intronic
984379620 4:178974852-178974874 ATTCAGCAGAAGCACCCTGTTGG + Intergenic
985351107 4:189062225-189062247 GCTCACCAGCACCACACTGTGGG + Intergenic
988412975 5:30910922-30910944 ATTCAGCAGGAACAAGCTGTTGG - Intergenic
991011596 5:61888409-61888431 GTTCAGCAGCACCACACTTTAGG + Intergenic
992654976 5:78900202-78900224 ATTCAGCAGCACCACACTGTAGG - Intronic
993414202 5:87605843-87605865 ATTCAGCAGTACCAACCTGTAGG - Intergenic
993920063 5:93790681-93790703 GCTCAGCAGTGCCACGCTGGGGG + Intronic
993936795 5:94014183-94014205 GTTCATCAGTATCACACTGTAGG + Intronic
994317561 5:98349724-98349746 GCTTAGCAGTACCATGCTGTAGG + Intergenic
994597170 5:101854205-101854227 GTTCAGCATCAGCACACTGTAGG + Intergenic
995278792 5:110308861-110308883 GTTTAGCAGCACCATACTGTAGG + Intronic
995827534 5:116317395-116317417 GTTCAACAGCAACATGCTGTAGG - Intronic
996113454 5:119592340-119592362 GTTCTGCAGCACCATGCTGTAGG + Intronic
997164583 5:131646191-131646213 ATTCTGTAGTACCACACTGTTGG - Intronic
998580700 5:143372416-143372438 GTTCAGCATCTCCATGCTGTAGG - Intronic
999412402 5:151363277-151363299 GTTCAGCAGCACCACACTGTAGG - Intergenic
1000806111 5:165794824-165794846 GTTCATCAGAACCATGCTGTGGG - Intergenic
1001734046 5:173984263-173984285 CTCCAGCAGCACCACGCTATGGG + Intronic
1002468353 5:179419667-179419689 GCTCTGCAATACCCCGCTGTAGG - Intergenic
1003079623 6:3010744-3010766 GTTCAGCAGCACCACACTGTAGG + Intronic
1003590867 6:7435581-7435603 ATTTAGCAGTACGACACTGTAGG + Intergenic
1004009253 6:11666208-11666230 ATTCAGCAGTACCAAGATGTTGG + Intergenic
1005063794 6:21798601-21798623 GTCCAGCAGTTCCAGGCTGCAGG - Intergenic
1007040805 6:38720357-38720379 GTTTGGCAGTACCATGCTGTGGG + Intronic
1007861731 6:44916922-44916944 GTTCAGGAGTTCAAGGCTGTGGG + Intronic
1013184005 6:107741586-107741608 GTTACGCAGTACCACACTGTAGG + Intronic
1013264182 6:108478495-108478517 GATCAACATTACCACCCTGTCGG - Intronic
1014130789 6:117829862-117829884 CTTCAGCAGCACCACACAGTAGG + Intergenic
1015216856 6:130760076-130760098 ATTCAGCAGCACCATGCTATAGG + Intergenic
1016263771 6:142207445-142207467 GTTCAGCAGTACCATGCTGTAGG + Intronic
1016615356 6:146041622-146041644 GTTCAGCAGCACCACATTGTAGG - Intronic
1017186425 6:151605412-151605434 GTTCAGCAGGACCACACTGTAGG - Intronic
1017934132 6:158989534-158989556 GTTCAGCAGCACCACATTGTAGG - Intronic
1019089949 6:169520158-169520180 GCTCAGCATCACCACACTGTAGG + Intronic
1019131338 6:169879117-169879139 GTTCAGCAGCACGAGGCTATAGG - Intergenic
1020466161 7:8482101-8482123 GTTCAGCAGTTTCACTCTGTTGG - Intronic
1021527187 7:21601513-21601535 GTTCATCAGTAGCTCTCTGTCGG - Exonic
1021771830 7:24010811-24010833 GTTCAGCAGCACCACACTGTAGG - Intergenic
1021866496 7:24963376-24963398 TGTCAGCAGTGCCACTCTGTGGG + Intronic
1025040637 7:55641525-55641547 GTTCAGTAACACCATGCTGTAGG - Intergenic
1028152156 7:87386736-87386758 GTTCAGCAGTGTTACGGTGTAGG - Intronic
1028560362 7:92168460-92168482 ATTCAGCAGCACCATGCTGTAGG + Intronic
1034087376 7:148332514-148332536 GTTCAGAAGGGCCACGCTCTGGG - Intronic
1036908048 8:12724398-12724420 GTTCTTCAGAAGCACGCTGTTGG + Intronic
1040774350 8:51021295-51021317 GTTCAGCATCACCATGCTATAGG + Intergenic
1041965029 8:63666647-63666669 GTTCAGCAGTACCCCACTTCTGG - Intergenic
1043033125 8:75164249-75164271 GTTCGGCAGCACCATGCTGAAGG - Intergenic
1044407584 8:91846564-91846586 ATTCAGCAGTATCATGCTATAGG + Intergenic
1047476657 8:125238851-125238873 GTTCTGCAGTAAGACACTGTGGG + Intronic
1049953590 9:670597-670619 GTTCGGCAGCACTATGCTGTAGG - Intronic
1050268752 9:3919074-3919096 GGTCAGCAGTACCATCCAGTTGG - Intronic
1050564335 9:6866466-6866488 GCTCAGCAGTGCTACACTGTAGG - Intronic
1050841821 9:10158979-10159001 GTTCAGCAGCACCATGTTGTAGG + Intronic
1052689544 9:31800037-31800059 GTTCAGCAGCACCATGCTATAGG + Intergenic
1052734671 9:32328812-32328834 GTTCAGCAGCACCGTGCTGTAGG + Intergenic
1055557331 9:77488527-77488549 GTTCAGCAGCATCACTCTGTAGG + Intronic
1057296303 9:93845023-93845045 GTTCACCAGCACCATGCTGTAGG - Intergenic
1060166955 9:121425315-121425337 GTTCAGCAGCACCACGCTGTGGG + Intergenic
1061323662 9:129849011-129849033 GTTCAGCAGGCCCAGGCTGCAGG - Intronic
1187941406 X:24386331-24386353 GTTCAGCAGCACCGTGTTGTAGG - Intergenic
1188382018 X:29506675-29506697 ATTCAGCAGTACTATACTGTAGG - Intronic
1188479026 X:30618444-30618466 GCTCAGCAGCACCATGCTATAGG + Intergenic
1188903135 X:35759739-35759761 GTTCAGTAGCACCACACTGTAGG - Intergenic
1190508151 X:51149158-51149180 GTTTAGCAGCACCACACAGTAGG - Intergenic
1192521931 X:71809823-71809845 GTTCAGCAGCGCCACACTGTAGG - Intergenic
1192718678 X:73669437-73669459 GCTCAGCAGTTCCACCATGTGGG - Intronic
1192760769 X:74094172-74094194 TTTCAGCAGCACCATGCTGGAGG + Intergenic
1193178247 X:78420874-78420896 GTTCAGCACCACCATGTTGTAGG + Intergenic
1194530037 X:95035917-95035939 GTTCATCAGCACCATGCTGTAGG - Intergenic
1195073568 X:101304636-101304658 GTTCAGCAGCATCATGCTGTAGG - Intergenic
1196882779 X:120213718-120213740 GTTTAGCAGCACCACACTGTAGG + Intergenic
1196987106 X:121286368-121286390 GTTCGGCAGCACCACACGGTAGG - Intergenic
1197260612 X:124313209-124313231 GTTCAGCAGCACCACACTGCAGG + Intronic
1199194821 X:145016010-145016032 ATTCAGCAGCACCATGCTATAGG + Intergenic
1199245045 X:145593953-145593975 GTTCAGCAGCAGCATGCTATAGG + Intergenic