ID: 1118547348

View in Genome Browser
Species Human (GRCh38)
Location 14:66906211-66906233
Sequence TCATGATTTAGCATCTCCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 253
Summary {0: 1, 1: 0, 2: 3, 3: 24, 4: 225}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118547343_1118547348 21 Left 1118547343 14:66906167-66906189 CCTGTGGGATGCACCTCCTACAG 0: 1
1: 4
2: 11
3: 31
4: 159
Right 1118547348 14:66906211-66906233 TCATGATTTAGCATCTCCTTTGG 0: 1
1: 0
2: 3
3: 24
4: 225
1118547342_1118547348 29 Left 1118547342 14:66906159-66906181 CCAGGGAACCTGTGGGATGCACC 0: 1
1: 0
2: 2
3: 38
4: 225
Right 1118547348 14:66906211-66906233 TCATGATTTAGCATCTCCTTTGG 0: 1
1: 0
2: 3
3: 24
4: 225
1118547346_1118547348 5 Left 1118547346 14:66906183-66906205 CCTACAGCGTGGTACTGCTGAAC 0: 2
1: 5
2: 19
3: 63
4: 114
Right 1118547348 14:66906211-66906233 TCATGATTTAGCATCTCCTTTGG 0: 1
1: 0
2: 3
3: 24
4: 225
1118547345_1118547348 8 Left 1118547345 14:66906180-66906202 CCTCCTACAGCGTGGTACTGCTG 0: 2
1: 3
2: 23
3: 56
4: 140
Right 1118547348 14:66906211-66906233 TCATGATTTAGCATCTCCTTTGG 0: 1
1: 0
2: 3
3: 24
4: 225
1118547341_1118547348 30 Left 1118547341 14:66906158-66906180 CCCAGGGAACCTGTGGGATGCAC 0: 1
1: 0
2: 4
3: 33
4: 199
Right 1118547348 14:66906211-66906233 TCATGATTTAGCATCTCCTTTGG 0: 1
1: 0
2: 3
3: 24
4: 225

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118547348 Original CRISPR TCATGATTTAGCATCTCCTT TGG Intronic