ID: 1118552640

View in Genome Browser
Species Human (GRCh38)
Location 14:66972566-66972588
Sequence GCCCCATTTTGTCACATTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 109}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118552637_1118552640 15 Left 1118552637 14:66972528-66972550 CCACCATCCTTTGGTATGCAGAA 0: 1
1: 0
2: 1
3: 16
4: 176
Right 1118552640 14:66972566-66972588 GCCCCATTTTGTCACATTCAAGG 0: 1
1: 0
2: 1
3: 10
4: 109
1118552635_1118552640 26 Left 1118552635 14:66972517-66972539 CCTTGAGACAACCACCATCCTTT 0: 1
1: 1
2: 2
3: 24
4: 259
Right 1118552640 14:66972566-66972588 GCCCCATTTTGTCACATTCAAGG 0: 1
1: 0
2: 1
3: 10
4: 109
1118552638_1118552640 12 Left 1118552638 14:66972531-66972553 CCATCCTTTGGTATGCAGAAGTA 0: 1
1: 0
2: 1
3: 18
4: 165
Right 1118552640 14:66972566-66972588 GCCCCATTTTGTCACATTCAAGG 0: 1
1: 0
2: 1
3: 10
4: 109
1118552639_1118552640 8 Left 1118552639 14:66972535-66972557 CCTTTGGTATGCAGAAGTATTTT 0: 1
1: 1
2: 40
3: 380
4: 2260
Right 1118552640 14:66972566-66972588 GCCCCATTTTGTCACATTCAAGG 0: 1
1: 0
2: 1
3: 10
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118552640 Original CRISPR GCCCCATTTTGTCACATTCA AGG Intronic
901320833 1:8339015-8339037 GCCCCATTTTATCTGATTCTAGG + Intronic
901573642 1:10182459-10182481 GCAGCATTTTATTACATTCACGG - Intergenic
905477722 1:38240611-38240633 CCCACATTTTGTCACCTTCTTGG - Intergenic
905547419 1:38810789-38810811 GCCCCAGATTATCACAGTCAGGG - Intergenic
909350015 1:74640919-74640941 GTCCCATTTTGCTACATTGAAGG + Intronic
909782398 1:79562514-79562536 GCCCCATTTGGTCAAAATGAAGG - Intergenic
910076215 1:83282251-83282273 AACCTATTTTGTCACATTCATGG - Intergenic
915031516 1:152883811-152883833 GCATCATTTTGTCCCATGCACGG - Intronic
917145414 1:171885464-171885486 GCCCCATATTCTCAGAGTCAAGG + Intronic
921993356 1:221391183-221391205 GCCCAATTTTGTGACATCAATGG + Intergenic
924453147 1:244197555-244197577 TCTACAGTTTGTCACATTCAAGG - Intergenic
1065456500 10:25911691-25911713 GGGCCATTGTTTCACATTCATGG - Intergenic
1066076550 10:31883620-31883642 TTCCCATTTTTGCACATTCAAGG + Intronic
1068972745 10:62976755-62976777 TCCCCATTTTGTCAGATAAAGGG - Intergenic
1069687867 10:70330651-70330673 GCCCCATTCTGTCTAATTCAAGG - Intronic
1070801963 10:79249071-79249093 CCCCCATTTTTTCACAGTCCTGG - Intronic
1070833094 10:79432178-79432200 GCCCCATCTCATCACATTCACGG - Intronic
1071472266 10:85992054-85992076 GCCCCATCTTGTCACACCCAGGG - Intronic
1079137567 11:17784591-17784613 GCTCCCTCCTGTCACATTCATGG - Intergenic
1080228669 11:29990455-29990477 GGCCCATTTTGCCACTTTGATGG - Intergenic
1081236610 11:40654408-40654430 GACTCAATTTCTCACATTCAGGG - Intronic
1088893798 11:114063299-114063321 GCCCATTTTTGTCAGATCCATGG - Exonic
1089387774 11:118079339-118079361 GCCCCTTTCTGTGACAGTCAGGG + Intronic
1095526492 12:43131882-43131904 ATCTCATTTTCTCACATTCAAGG + Intergenic
1108238893 13:48440899-48440921 GCCCTATATTGTAATATTCAAGG + Intronic
1111151975 13:84264697-84264719 GCTCAATGTTATCACATTCAAGG - Intergenic
1111821288 13:93218517-93218539 GCCCAACTGTGTCACATTCTGGG - Intergenic
1115006232 14:28488909-28488931 GACCCATTGTCTCATATTCAGGG - Intergenic
1117834424 14:59787603-59787625 ACACAATTTTATCACATTCATGG - Intronic
1118552640 14:66972566-66972588 GCCCCATTTTGTCACATTCAAGG + Intronic
1118552644 14:66972612-66972634 TTCCCATTTTGTCACATTCAAGG + Intronic
1119492527 14:75049009-75049031 TCCCGATTTTGTCAAATTTATGG - Exonic
1120948720 14:90021693-90021715 GCCCCATTATAGCACATTCCAGG + Intronic
1123947084 15:25244012-25244034 GCCCCATGCTGCCTCATTCATGG - Intergenic
1123947895 15:25247744-25247766 GCCCCATGCTGCCTCATTCATGG - Intergenic
1124605865 15:31169962-31169984 GCCCAAATTTGTCAAAATCAAGG - Intergenic
1125511964 15:40296931-40296953 GCACCATCTTCTCACCTTCATGG + Intronic
1126839514 15:52703446-52703468 GCACCATTTTGTCAAACTGATGG - Intronic
1127333667 15:57963274-57963296 GACCCATCTTGTCATACTCATGG + Intronic
1128872454 15:71171983-71172005 GCTTCATTTTGTCACTTTGATGG - Intronic
1130065284 15:80597623-80597645 CCTCCATTTTGCCACTTTCAAGG - Exonic
1130163150 15:81422788-81422810 GCCAGATTTTCTCACATTCCAGG - Intergenic
1131363908 15:91821190-91821212 GCCACATCTTGTCACTTCCAGGG - Intergenic
1133881165 16:9783883-9783905 ACCCCATGTTCTCACTTTCAAGG + Intronic
1139237463 16:65355173-65355195 GCCCCATTCTGTCTCTTTCTTGG - Intergenic
1140261933 16:73388141-73388163 TGGCCATTTTGTCACATCCAAGG - Intergenic
1142994617 17:3753330-3753352 GCTCCATTTTACCACGTTCATGG - Exonic
1143901731 17:10179529-10179551 GTCACATTTTATCACATGCAGGG + Intronic
1144192391 17:12858528-12858550 GCCCCCTTTTGCTACTTTCAAGG - Intronic
1144843186 17:18201344-18201366 GCCCAAGTTTGTCACCTTCCTGG - Intronic
1147922554 17:43927066-43927088 GCCCCATTTGGTTCCATTCCTGG - Intergenic
1148890850 17:50806092-50806114 GCCCCATTTTCTCCACTTCAGGG + Intergenic
1151380952 17:73725494-73725516 GCCCAAGTGTGTCAGATTCAGGG - Intergenic
1155792347 18:29989085-29989107 GCAACTTTTTGTCAGATTCATGG + Intergenic
1158438642 18:57453555-57453577 GTGCCATTTCTTCACATTCAGGG - Intronic
1161868302 19:6850830-6850852 ACCCCCTTTTCCCACATTCAGGG + Intronic
1165412177 19:35668751-35668773 TCCCCATGGTGTCACACTCAGGG + Intronic
929636367 2:43525745-43525767 GACACATTTTATTACATTCATGG - Intronic
931434699 2:62236322-62236344 GCCCCCTGCTGTCACATTCCTGG + Intergenic
933541519 2:83649347-83649369 GCACCATTATGTCAGATTCTAGG + Intergenic
934944350 2:98527198-98527220 ACCCCATTCTGTCCCCTTCAGGG - Intronic
934973791 2:98786220-98786242 GTCCCCTGTAGTCACATTCAGGG + Intergenic
935699958 2:105802795-105802817 GCCCCCATGTGTCACATACATGG + Intronic
936175042 2:110212317-110212339 GCCCCATTCTGTCCCCCTCATGG - Intergenic
939898249 2:147818423-147818445 CCCCCATTTTCTAGCATTCAGGG - Intergenic
947609593 2:231515613-231515635 GCCATATTTTGGCACATTTATGG - Intergenic
1176927350 21:14766317-14766339 TCTCCATGTTGTCACATTAATGG + Intergenic
950500023 3:13357877-13357899 GCCCCATTTTAACACCCTCAAGG + Intronic
950606336 3:14084613-14084635 CCCCCAGTTTGGCACATCCAAGG + Intergenic
955079423 3:55644549-55644571 GCCCCATATGGTCACTGTCAGGG + Intronic
955527454 3:59836055-59836077 GCTGCATTTAGTAACATTCATGG - Intronic
960920466 3:122741846-122741868 GCCCCTTTTTGCCAATTTCATGG - Intronic
965678473 3:171224787-171224809 TCCCCATTTTGTCACAGTCTGGG - Intronic
967689078 3:192452720-192452742 TCCACATTTTGACACAATCACGG - Intronic
969957674 4:10908343-10908365 GGCCCATCTTTTCACAGTCAGGG - Intergenic
976217910 4:82731980-82732002 GGCCCTAATTGTCACATTCATGG - Intronic
976557915 4:86470111-86470133 ACCCCCTTTTGTGACTTTCATGG - Intronic
980222229 4:129933219-129933241 GCCACATTTTTTTAGATTCAGGG - Intergenic
987394242 5:17406836-17406858 TCCCCATATTGTCACAATCTGGG + Intergenic
988534787 5:32057491-32057513 GTCCCATTTTGTGACATTCCTGG + Intronic
990780062 5:59350498-59350520 GCTTCCTTTTGCCACATTCATGG - Intronic
996312259 5:122120118-122120140 TCCTCATTTTGTTTCATTCATGG + Intergenic
1008425710 6:51353489-51353511 GCCCCATTTTGTGACCTCCCTGG - Intergenic
1012690184 6:102300398-102300420 GCTCCATTTTGTCCCATTACGGG - Intergenic
1015362822 6:132359892-132359914 TCCCCATTTTGTAATATTGAAGG - Intronic
1019348664 7:543037-543059 GCCTAATTTGGTCACATTCCAGG + Intergenic
1020446657 7:8276028-8276050 GTGCCATTTTGTTACATTCATGG + Intergenic
1021388135 7:20057844-20057866 GTCCCTTTTTATCACATTCATGG - Intergenic
1022389443 7:29930578-29930600 GGCCCATTTCATCACATGCATGG + Intronic
1022598024 7:31731256-31731278 GCCCCACTTTGGCACCTACACGG - Intergenic
1022850684 7:34258652-34258674 GCCCCACTTTGTCACTTCCAGGG - Intergenic
1026459616 7:70602125-70602147 GCCCCAATATGTCATTTTCAAGG - Intronic
1027293989 7:76747428-76747450 AACCTATTTTGTCACATACATGG - Intergenic
1030610736 7:111686321-111686343 CCACCATTTTATCATATTCATGG - Intergenic
1033016828 7:137680034-137680056 TCCACATTCTGTCACATTGAGGG - Intronic
1034529866 7:151689005-151689027 GCCACATTTTCTCCTATTCAGGG - Intronic
1035008792 7:155692478-155692500 TCCCCATTGTGACACATTCAGGG + Intronic
1035021256 7:155802159-155802181 TCACCATTTTGCCACATTCTTGG - Exonic
1037104290 8:15085908-15085930 CCCACATTTTGTAGCATTCATGG - Intronic
1037805348 8:22055534-22055556 GCCCCTTTCTGCCACATTGAAGG + Intronic
1038474315 8:27853472-27853494 GACCCATCTTGTCACAAGCAAGG - Intergenic
1039635163 8:39156891-39156913 GCCTCATTTTGTGACATACTGGG + Intronic
1042863243 8:73334450-73334472 CCACCATCTTGTCACAGTCATGG + Intergenic
1045067183 8:98459590-98459612 GCCCCATTTCATCACAGGCATGG + Intronic
1047653515 8:126950141-126950163 TCTCCATTTTGTCAAATCCAAGG - Intergenic
1048535058 8:135285303-135285325 GACCCATTTTGTCCCTTTCTAGG + Intergenic
1049002577 8:139835432-139835454 GCCCCATTGTGTCACTGTGATGG + Intronic
1052045989 9:23794524-23794546 GCCCCCATTTTTCAAATTCAAGG + Intronic
1054741103 9:68806543-68806565 TCCTTAATTTGTCACATTCATGG + Intronic
1056320711 9:85432346-85432368 GCACCACTCTGACACATTCATGG + Intergenic
1060237555 9:121876552-121876574 GCACCTTTCTCTCACATTCAGGG - Intronic
1060515242 9:124261516-124261538 GCCCCCTGATGTCACCTTCACGG + Intronic
1062054094 9:134461996-134462018 GGCCCATTTTCTCACATGCCTGG + Intergenic
1062083846 9:134638453-134638475 GCCCCACTCTGTCCCATGCAGGG - Intergenic
1062163080 9:135090455-135090477 GCCCCATTTTGACTCTTTCCTGG + Intronic
1186959118 X:14715784-14715806 GCTCCTTTGTGTGACATTCAAGG - Intronic
1192208735 X:69113185-69113207 GCCCCATTTTGTCAGACTATAGG - Intergenic
1195407697 X:104534581-104534603 GCTCCATTTTGTCATCTGCATGG - Intergenic
1196223345 X:113137686-113137708 TGGCAATTTTGTCACATTCATGG + Intergenic
1198303460 X:135354593-135354615 GCACCATGTTCTCACATCCAAGG + Intronic
1200145125 X:153922391-153922413 GCCCCATTCTTTCACTTACAAGG - Intronic