ID: 1118553764

View in Genome Browser
Species Human (GRCh38)
Location 14:66989018-66989040
Sequence GAGATACACATGACTATGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 143}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118553764 Original CRISPR GAGATACACATGACTATGTG TGG (reversed) Intronic
900734753 1:4291563-4291585 GAGGTACACATGCATAGGTGGGG + Intergenic
905939489 1:41851929-41851951 GAGATTTACATGACTTTTTGAGG - Intronic
906643365 1:47455278-47455300 GAGGTTCACATGAGTGTGTGTGG + Intergenic
907845241 1:58199702-58199724 GAGAAACACATGACTTTAAGAGG - Intronic
911269622 1:95784985-95785007 GAGATAGATATGATTATGAGAGG + Intergenic
911715532 1:101128307-101128329 CAAATTCACATGACTCTGTGTGG + Intergenic
911823447 1:102448375-102448397 GAGATACAAATGAGTATGCTGGG + Intergenic
915380258 1:155433662-155433684 GATATACACAGGCCGATGTGGGG + Intronic
917417519 1:174826055-174826077 CAGATACTCAGGACTATTTGAGG - Intronic
919283012 1:195517196-195517218 GAGATATACATTTATATGTGTGG - Intergenic
923761782 1:236852767-236852789 AAGATACAAATGAATAGGTGTGG - Intronic
1064130103 10:12701912-12701934 GAGATACCTATATCTATGTGTGG - Intronic
1068163843 10:53302641-53302663 GAGAGAAAGATGAATATGTGAGG - Intergenic
1070090162 10:73276862-73276884 AACATACACAGTACTATGTGGGG - Intronic
1075631039 10:124000841-124000863 GAGACACACCGGGCTATGTGGGG + Intergenic
1076206173 10:128605456-128605478 TAGATTCACATGCCTCTGTGTGG + Intergenic
1079020946 11:16908361-16908383 GACACAGAGATGACTATGTGAGG + Intronic
1079260827 11:18878546-18878568 GAGATACAAGTGAATATTTGAGG + Intergenic
1079721599 11:23821557-23821579 TAGATACAAATGACAATGTAAGG + Intergenic
1080311549 11:30898909-30898931 GAGATACAAATGATTCTTTGGGG - Intronic
1084237066 11:67795047-67795069 TAGGTACTCATAACTATGTGTGG + Intergenic
1084314578 11:68337700-68337722 GAGGTAGACCTGACTATGGGTGG - Intronic
1085972975 11:81615991-81616013 TAGAAACCCATGACTAGGTGGGG + Intergenic
1095351021 12:41212858-41212880 AAGAGACAGATGAGTATGTGCGG + Intronic
1098634674 12:72767508-72767530 GAAATACACATTTCTATCTGTGG - Intergenic
1104186748 12:126440005-126440027 GAGAAAAATATGGCTATGTGGGG + Intergenic
1104194249 12:126516894-126516916 CACACACACATAACTATGTGAGG - Intergenic
1106637428 13:31543862-31543884 GAGAATCACTTGACTATGGGAGG + Intergenic
1108270004 13:48750215-48750237 GAGAGACACACGACTAGATGAGG - Intergenic
1112117408 13:96371439-96371461 CACATACACGTAACTATGTGAGG - Intronic
1112389190 13:98967299-98967321 GAACTACACATAACTATGTGTGG - Intronic
1112951370 13:105001155-105001177 GAGACACACCTGACTGTGGGAGG - Intergenic
1113480075 13:110614340-110614362 GAGATAACTATAACTATGTGTGG - Intergenic
1114744280 14:25131065-25131087 GAGATACACATCACTGGGTACGG + Intergenic
1115280493 14:31656437-31656459 AAGATACACATGATTATGCTTGG - Intronic
1115421130 14:33197335-33197357 AAGAGACACATTCCTATGTGAGG - Intronic
1115767580 14:36639314-36639336 GGGAGATACATGACTATCTGAGG + Intergenic
1116333512 14:43626473-43626495 GAAATACAGTTGACTATGTCAGG - Intergenic
1117828270 14:59726082-59726104 TAGAGTCACATGACTAAGTGAGG - Intronic
1118553764 14:66989018-66989040 GAGATACACATGACTATGTGTGG - Intronic
1121075190 14:91061743-91061765 GAGATACAGCTGACAAGGTGAGG + Intronic
1122334270 14:100959041-100959063 TAGATACATATGTCTAAGTGTGG + Intergenic
1126044329 15:44624684-44624706 TAGACACACATAACTATGTGAGG + Intronic
1127307195 15:57719022-57719044 AAGATATTCATGACTGTGTGAGG + Intronic
1128285926 15:66436997-66437019 GGGATCCACATCACTATCTGGGG + Intronic
1134246917 16:12547067-12547089 GAGGCAGACATGCCTATGTGAGG + Intronic
1134359366 16:13517011-13517033 TGGATAGACATGACTATGTGGGG - Intergenic
1134730944 16:16461587-16461609 GATATTCACATGCCCATGTGAGG + Intergenic
1146486736 17:33249209-33249231 GAGATACAGAAGACTGTGGGTGG + Intronic
1147165402 17:38590557-38590579 GAGATCATCATGAATATGTGTGG - Intronic
1148887975 17:50787204-50787226 GAGAGACCCATGGATATGTGAGG - Intergenic
1149799051 17:59549297-59549319 GAGATACAGATGCCTCTGGGAGG - Intergenic
1151355969 17:73558750-73558772 GAGAGACACATGGCTTGGTGCGG - Intronic
1153582919 18:6593652-6593674 GAGGTACACATGACTGGGGGAGG - Intergenic
1154153751 18:11927913-11927935 GAGTTGGACATGACTATCTGAGG + Intergenic
1156621402 18:38856094-38856116 GAGATGCATAAGACAATGTGTGG - Intergenic
1159267077 18:66095506-66095528 CAGATATACATAAATATGTGAGG - Intergenic
1159761111 18:72428684-72428706 GAGATAGACATGGCTGGGTGTGG + Intergenic
925227614 2:2199425-2199447 CAGATACCCATGACTATCTGCGG + Intronic
937242687 2:120472566-120472588 GAGACACACATGTGCATGTGTGG + Intergenic
938241212 2:129743666-129743688 TAGATTCCCATGAATATGTGTGG + Intergenic
938592666 2:132754427-132754449 GATATAAACATGACTATTTTGGG - Intronic
939300311 2:140329157-140329179 GAGGTACCCATGAGTATGTAGGG - Intronic
941834525 2:170001821-170001843 GAGAATCACTTGACTCTGTGAGG + Intronic
942464255 2:176190418-176190440 GAATTGCACATGACTAAGTGAGG - Exonic
943749535 2:191496983-191497005 GAGAGCCGCATGACTATGTGAGG + Intergenic
943902117 2:193454124-193454146 GAGAAATACCTGACTATCTGTGG + Intergenic
946144865 2:217723193-217723215 GAGAAACACATGTCGATGAGTGG - Intronic
948947877 2:241230419-241230441 GAGATACACCTAACTTGGTGTGG - Intronic
1175480841 20:59309614-59309636 GAGATAGAAATGGTTATGTGAGG - Intronic
1176337838 21:5615558-5615580 GAGAAATACATCACAATGTGGGG - Intergenic
1176339246 21:5678631-5678653 GAGAAATACATCACAATGTGGGG - Intergenic
1176471500 21:7110784-7110806 GAGAAATACATCACAATGTGGGG - Intergenic
1176495061 21:7492562-7492584 GAGAAATACATCACAATGTGGGG - Intergenic
1176505581 21:7645825-7645847 GAGAAATACATCACAATGTGGGG + Intergenic
1177403299 21:20634301-20634323 GAGTAACAAATGACTAGGTGTGG - Intergenic
1178427773 21:32492525-32492547 GACATGCACAGGACTTTGTGTGG + Intronic
1183274687 22:36886329-36886351 GAGGTAGACAGGACTATGTGTGG - Intergenic
952454269 3:33458014-33458036 GTTATACACATGCCTATCTGAGG + Intergenic
952482182 3:33772916-33772938 GAGTTAAAAATGACAATGTGTGG + Intergenic
952804257 3:37332064-37332086 GACAGACAGATGACTATGTTAGG - Intronic
953742878 3:45552251-45552273 CAGATACACATGAGGAAGTGTGG - Intergenic
957835915 3:85589130-85589152 GAGAGACACATGTTTGTGTGTGG + Intronic
961918369 3:130400363-130400385 GAGATACAAATGAATAAGTCAGG - Intronic
964496240 3:157293344-157293366 GAGGTACACATGACTATATGAGG + Intronic
965048983 3:163619437-163619459 GAGATAGACATGACCACATGAGG - Intergenic
966045360 3:175542359-175542381 CAGATACATATGACAATTTGGGG - Intronic
966861979 3:184235640-184235662 GAGGTACACATGGCTGTGTGTGG - Intronic
966861984 3:184235670-184235692 GAGGTACACATGGCTGTGTGTGG - Intronic
966861989 3:184235700-184235722 GAGGTACACATGGCTGTGTGTGG - Intronic
966861994 3:184235730-184235752 GAGGTACACATGGCTGTGTGTGG - Intronic
966862004 3:184235790-184235812 GAAGTACACATGACTGTGTGTGG - Intronic
966862012 3:184235848-184235870 GAGGTGTACATGACTGTGTGTGG - Intronic
966862016 3:184235878-184235900 GAGGTATACATGACTGTGTGTGG - Intronic
966862024 3:184235936-184235958 GAGGTACACATGACTGTGTGTGG - Intronic
967327519 3:188256856-188256878 GAGGTACACATGCATACGTGTGG + Intronic
967339379 3:188379269-188379291 GAGATACAAATGACATTCTGAGG + Intronic
969758165 4:9163592-9163614 TAGGTACTCATAACTATGTGTGG - Intergenic
972082267 4:35167903-35167925 GAAATTCAAATGACTAAGTGTGG - Intergenic
972448313 4:39168801-39168823 GACATACTCATGAATATGAGTGG - Intergenic
975429232 4:74268664-74268686 GAGTTACAGATGACTATGATAGG + Intronic
978716458 4:111849093-111849115 GAGATACACAGCACTTTCTGAGG - Intergenic
978971984 4:114819618-114819640 TAGATACATCTGATTATGTGGGG + Intergenic
980397742 4:132236847-132236869 CAGAGACACATGAAAATGTGGGG - Intergenic
982970945 4:161985938-161985960 CAGTTACACATGATTATGTCAGG - Intronic
988129885 5:27090457-27090479 GAAAAACACATGAATATGTATGG - Intronic
990927286 5:61041369-61041391 GAGGTACTAATGACTATTTGAGG + Intronic
993828207 5:92720134-92720156 GATATTTACATGACTATGTCAGG - Intergenic
995225437 5:109695169-109695191 CAGATACTCATGACTGTCTGTGG + Intronic
1000802866 5:165750558-165750580 GAGATAAAAAGGACTATGAGAGG + Intergenic
1000948761 5:167454535-167454557 GACACACACATAAATATGTGTGG - Intronic
1002366594 5:178717327-178717349 GAGGTACAGATGACTATGCCAGG + Intronic
1005401192 6:25436398-25436420 ATGCTACACATGTCTATGTGGGG - Intronic
1006029090 6:31165949-31165971 GATATACACAGGCCGATGTGGGG - Exonic
1007041804 6:38728913-38728935 GAGATACTCATGGCCAGGTGTGG + Intronic
1007437122 6:41822265-41822287 GCCATACAAATGACCATGTGTGG - Intronic
1010094134 6:72019835-72019857 TAAATTCACATGCCTATGTGGGG - Intronic
1010855828 6:80837746-80837768 AAGAGACACATGCCTATTTGTGG - Intergenic
1011210754 6:84954049-84954071 GAGAGACACATGAGGATGTTTGG + Intergenic
1014104347 6:117546294-117546316 CAGATACATAGGACTCTGTGGGG + Intronic
1015203821 6:130612909-130612931 GAGATGCAAAGGACTGTGTGCGG - Intergenic
1017305492 6:152913774-152913796 GAGAACCTGATGACTATGTGGGG + Intergenic
1017899866 6:158710226-158710248 GAAATACACATTACTATGGCTGG + Intronic
1017935616 6:159002204-159002226 TAGATACACATAACTATTTGTGG - Intergenic
1018222636 6:161596276-161596298 GAGAAACACATTACTATGGTTGG + Intronic
1020320092 7:6933553-6933575 TAGGTACTCATAACTATGTGTGG + Intergenic
1021403240 7:20234313-20234335 GAGTTTCACATGGCTATGAGAGG - Intergenic
1024431504 7:49293543-49293565 AAGATGCAGATTACTATGTGTGG - Intergenic
1024829933 7:53439061-53439083 TACATACACATAGCTATGTGTGG - Intergenic
1027652241 7:80883014-80883036 GAGATACACCTGAATCTCTGAGG + Intronic
1029676303 7:102071434-102071456 GTGATGGACATAACTATGTGGGG + Intronic
1030214030 7:107025096-107025118 GAGATAGAGATGGCAATGTGGGG + Intergenic
1030633260 7:111918622-111918644 GAGACACCCATGATTAGGTGGGG - Intronic
1032842035 7:135721939-135721961 GAGATAGGAATCACTATGTGTGG + Intronic
1034898203 7:154891086-154891108 CAGGTACACATGACTACGTCCGG - Intronic
1036093642 8:5697960-5697982 TAGATACACATGATTATATATGG - Intergenic
1037184581 8:16047351-16047373 GAGAATCACTTGAATATGTGAGG + Intergenic
1041031345 8:53738578-53738600 TAGGTGCACATGACTAAGTGTGG - Intronic
1041217639 8:55616474-55616496 GAGGGACACTTGACTATATGAGG - Intergenic
1043927928 8:86059080-86059102 CAGGCACACATCACTATGTGTGG + Intronic
1044147306 8:88733015-88733037 ATGATACACATGACTATGGGTGG + Intergenic
1045520022 8:102895416-102895438 GACATACACCTCACTGTGTGAGG + Intronic
1047697335 8:127416348-127416370 GATATACACAGGCCGATGTGGGG + Exonic
1048111920 8:131476979-131477001 GAGAAACAAATGACTCTGGGTGG + Intergenic
1049644647 8:143730609-143730631 GGGAGACACATGACTAGGGGTGG + Intronic
1051196414 9:14566715-14566737 GATATTCACATGATTGTGTGGGG - Intergenic
1054783402 9:69187177-69187199 AACATACACATGTCTATGTGGGG + Intronic
1055339629 9:75267115-75267137 GAGATGGACATGATTATGTTGGG - Intergenic
1055670084 9:78595833-78595855 GAGAAAGACATGACTTTTTGAGG + Intergenic
1056757276 9:89389646-89389668 AAACTACACATGACTGTGTGTGG + Intronic
1057082215 9:92181428-92181450 GGGGTACAGATGACTCTGTGAGG + Intergenic
1059327796 9:113514836-113514858 GAGATACACAGGAAAAAGTGAGG + Intronic
1059506644 9:114805230-114805252 TAGATACACATTCCTATATGTGG - Intronic
1203423830 Un_GL000195v1:19358-19380 GAGAAATACATCACAATGTGGGG + Intergenic
1190117375 X:47635447-47635469 GTGACACGCATGACTGTGTGTGG - Intergenic
1190606963 X:52153593-52153615 GAGATACATCTGAATATGTGGGG + Intergenic
1191578135 X:62729735-62729757 GAGATAAATATGTCTATCTGGGG + Intergenic
1193629555 X:83865940-83865962 GGGATAGACATGAATATTTGGGG - Intronic
1194432309 X:93824279-93824301 GACTGACACATGATTATGTGTGG - Intergenic
1196300510 X:114046052-114046074 GAGATACACAGGACAAGGTAAGG - Intergenic
1197599418 X:128510192-128510214 GAGAAAGACATGAATATGGGGGG + Intergenic
1198817108 X:140603380-140603402 GACAAACAGATGGCTATGTGAGG - Intergenic