ID: 1118554021

View in Genome Browser
Species Human (GRCh38)
Location 14:66993254-66993276
Sequence TGTATGTGTGTGTGTAGAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 8941
Summary {0: 1, 1: 26, 2: 348, 3: 1974, 4: 6592}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118554021_1118554026 10 Left 1118554021 14:66993254-66993276 CCCCCTCTACACACACACATACA 0: 1
1: 26
2: 348
3: 1974
4: 6592
Right 1118554026 14:66993287-66993309 TCAAATATGGAACTCTAATGTGG 0: 1
1: 0
2: 0
3: 7
4: 161
1118554021_1118554025 -3 Left 1118554021 14:66993254-66993276 CCCCCTCTACACACACACATACA 0: 1
1: 26
2: 348
3: 1974
4: 6592
Right 1118554025 14:66993274-66993296 ACACACAAAGTCTTCAAATATGG 0: 1
1: 0
2: 2
3: 33
4: 314

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118554021 Original CRISPR TGTATGTGTGTGTGTAGAGG GGG (reversed) Intronic
Too many off-targets to display for this crispr