ID: 1118564242

View in Genome Browser
Species Human (GRCh38)
Location 14:67121971-67121993
Sequence CCAATTTGATAATAATGCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 1, 2: 0, 3: 5, 4: 134}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118564242_1118564245 -8 Left 1118564242 14:67121971-67121993 CCAGAGCATTATTATCAAATTGG 0: 1
1: 1
2: 0
3: 5
4: 134
Right 1118564245 14:67121986-67122008 CAAATTGGAGCCCAACCTGGTGG 0: 1
1: 0
2: 0
3: 6
4: 101
1118564242_1118564246 -7 Left 1118564242 14:67121971-67121993 CCAGAGCATTATTATCAAATTGG 0: 1
1: 1
2: 0
3: 5
4: 134
Right 1118564246 14:67121987-67122009 AAATTGGAGCCCAACCTGGTGGG 0: 1
1: 0
2: 0
3: 6
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118564242 Original CRISPR CCAATTTGATAATAATGCTC TGG (reversed) Intronic
906559375 1:46744788-46744810 TCAATTTGTTAAGAATTCTCAGG - Intergenic
910150368 1:84135406-84135428 TCAAATTGATAGTACTGCTCAGG - Intronic
910314360 1:85865768-85865790 CAAATTTGACAAGAATGATCAGG + Intronic
913201902 1:116501672-116501694 CCAATGTCATAATAATCTTCAGG - Intergenic
915414714 1:155732592-155732614 TGACTTTGATAATTATGCTCAGG - Intronic
917741239 1:177963935-177963957 TCAATTTGATAAAAATGCAAAGG + Intronic
919405360 1:197174423-197174445 ACATTTTGCTAATTATGCTCAGG + Intronic
921061415 1:211588226-211588248 ACAATTAGATAAAAATGCTGTGG - Intergenic
921683800 1:218066706-218066728 CCTATTTGATAGAAAGGCTCTGG - Intergenic
1066031713 10:31433894-31433916 CCATTTTTATAATAATACTAAGG - Intronic
1066257749 10:33696722-33696744 CCTATTTGATCATCTTGCTCAGG + Intergenic
1067961347 10:50854416-50854438 CCAATGTAATATTAATGGTCAGG - Intronic
1070910796 10:80116198-80116220 CTAATTTCATAATACTGCTGAGG - Intergenic
1074917921 10:117975728-117975750 CCAATTTTAAAGCAATGCTCGGG - Intergenic
1075912754 10:126139960-126139982 ATAATTGGATCATAATGCTCTGG + Intronic
1079880383 11:25920387-25920409 TAAATTTGATAATCATGCTAAGG + Intergenic
1079924290 11:26473626-26473648 TCAGTTTGATAATAGTGGTCTGG - Intronic
1079960258 11:26914920-26914942 CCATTATGATTAGAATGCTCTGG - Intergenic
1080548440 11:33346373-33346395 CCAATTTGATGATAAAACTAAGG - Intronic
1085564884 11:77504640-77504662 CCACTTTCATAATAATACTAAGG - Intergenic
1085995380 11:81906345-81906367 ACAATTTGATAATAATCAGCTGG + Intergenic
1087930217 11:103968413-103968435 AAAATTTGATAATAATACTTTGG - Intronic
1094181916 12:27600633-27600655 TCAAATTCAGAATAATGCTCAGG - Intronic
1097350990 12:58548915-58548937 CCAATTGGATCATAATACTAGGG - Intronic
1098578224 12:72069163-72069185 CCTATATGACAATAATACTCTGG - Intronic
1098626497 12:72677507-72677529 CCAATTTTATAAAAATTCTGTGG + Intergenic
1101887945 12:108684844-108684866 CAAATTTAATAATAATGCATTGG - Intronic
1105719678 13:23101258-23101280 CCATTTTGAAAAAAATGCTCAGG + Intergenic
1109359149 13:61273052-61273074 CCAATTTGAAGCCAATGCTCTGG + Intergenic
1111386231 13:87531956-87531978 TCAATTTGATAATAAATCTTTGG + Intergenic
1113186951 13:107698675-107698697 CCAATTTGTTCATAATGATTGGG + Intronic
1113987912 13:114333779-114333801 CCAGTGTGAGAATAGTGCTCAGG + Intergenic
1118564242 14:67121971-67121993 CCAATTTGATAATAATGCTCTGG - Intronic
1119986931 14:79148746-79148768 CCAATTTAATAAACATTCTCTGG + Intronic
1122954523 14:105064357-105064379 CCAATTTGATAGTGTTGCCCAGG + Intronic
1124186513 15:27534472-27534494 CCAGTTAGTTAATAATGCTTTGG + Exonic
1125149615 15:36517008-36517030 CAATTTTGACAATAATGGTCAGG - Intergenic
1126451854 15:48817152-48817174 CCAATTTTATAATCTTGCTTTGG - Intergenic
1126992637 15:54399736-54399758 GCAATTTGAAACTAATGTTCTGG - Intronic
1127718101 15:61670855-61670877 CCTATTTGATTATAATAGTCAGG - Intergenic
1127973709 15:63981972-63981994 CTAATTTGAGAACTATGCTCTGG - Intronic
1131863104 15:96675666-96675688 TCTATTTCATAATAATGCCCAGG - Intergenic
1138856691 16:60702173-60702195 CCAATCTGATTATTATGCTTTGG - Intergenic
1147507068 17:41029263-41029285 GCAATTTGATAATAATACCAAGG - Intergenic
1155889964 18:31255514-31255536 CCCATTTCACAACAATGCTCAGG + Intergenic
1162227629 19:9237054-9237076 CGAATTTCATAAAAATACTCAGG + Intergenic
924959898 2:25022-25044 CCAGTGTGAGAATAGTGCTCAGG - Intergenic
925811611 2:7706695-7706717 CCAATTTGATTCCAAAGCTCAGG - Intergenic
928997338 2:37307018-37307040 CCAAAATGTTAATAATGCTGAGG - Intronic
932866351 2:75347137-75347159 CCCATCTGATCACAATGCTCAGG + Intergenic
939491711 2:142884620-142884642 TAAATTAGATAATAGTGCTCAGG - Intronic
940397487 2:153207645-153207667 CCAATTTCAAAATAATGATTTGG + Intergenic
941149333 2:161894224-161894246 CCATTTTGAAAATAATACTAAGG - Intronic
942264502 2:174208283-174208305 CTAATTTAATAATAATGGTTTGG - Intronic
942541732 2:177022191-177022213 CCCATTTGACAAACATGCTCAGG - Intergenic
944865424 2:203855226-203855248 GCAATTTTAGAATAATTCTCTGG - Intergenic
946614966 2:221499443-221499465 ACAATTTTATAATTATGCCCAGG - Intronic
946936662 2:224728913-224728935 CCTGTTTTATATTAATGCTCAGG - Intergenic
1172345781 20:34197672-34197694 CCTAATTTATAATAATGCTGAGG - Intronic
1176347266 21:5760809-5760831 CCAATTAATTAAAAATGCTCTGG - Intergenic
1176354080 21:5881393-5881415 CCAATTAATTAAAAATGCTCTGG - Intergenic
1176497561 21:7563646-7563668 CCAATTAATTAAAAATGCTCTGG + Intergenic
1176541587 21:8158879-8158901 CCAATTAATTAAAAATGCTCTGG - Intergenic
1176560538 21:8341924-8341946 CCAATTAATTAAAAATGCTCTGG - Intergenic
1176669070 21:9715210-9715232 CCAATTGCATAATAATGTTAGGG - Intergenic
1176880772 21:14190390-14190412 TTAATTTGATAATAATATTCAGG + Intronic
1183864843 22:40695863-40695885 ACACTTTAATAATAATGCCCTGG + Intergenic
1203246526 22_KI270733v1_random:75298-75320 CCAATTAATTAAAAATGCTCTGG - Intergenic
949683702 3:6544217-6544239 CCAATGTGAGAATATTCCTCAGG + Intergenic
949753535 3:7382219-7382241 CCAAGTTGATGATAATTATCAGG + Intronic
952950153 3:38516585-38516607 CGAATTTGATAATTATTCTGTGG - Intronic
957915291 3:86681240-86681262 CATATTTGATAATATTGTTCAGG - Intergenic
958578421 3:95984406-95984428 CCAATTTGCTAACCATACTCTGG + Intergenic
959438101 3:106342366-106342388 CCAATTAGATAAAAACTCTCTGG - Intergenic
962369455 3:134808763-134808785 TAAATTTGATCATGATGCTCAGG - Intronic
962653998 3:137524082-137524104 CCTATTTGATGATAAAGATCTGG + Intergenic
964705121 3:159610103-159610125 CAGATTTGATAGAAATGCTCAGG + Intronic
966565843 3:181380381-181380403 CAAATTAGAAAAAAATGCTCTGG - Intergenic
967522526 3:190450675-190450697 CCAATCTGATTATAATTCTAAGG - Intergenic
969342780 4:6552821-6552843 CTAATTTGACAATAAGGCTCAGG + Intronic
970973744 4:22018292-22018314 TCAAATTGTTAATAATGCTGAGG - Intergenic
971516625 4:27495119-27495141 CCAATCTGATAATAACTCACTGG + Intergenic
973291430 4:48474850-48474872 CAAGTATGATAAAAATGCTCAGG + Intergenic
974305219 4:60128108-60128130 CTAATCACATAATAATGCTCAGG - Intergenic
974941696 4:68477217-68477239 CCAATTTGATAATAAGGCTCAGG - Intronic
975274872 4:72484947-72484969 CCAATCTGATGTAAATGCTCAGG - Intronic
976472598 4:85447236-85447258 CCAATTTCATAATAAGGGTAAGG - Intergenic
976700368 4:87963812-87963834 CCAATTTTATAAAACTGCTGTGG + Intergenic
978790351 4:112657077-112657099 CAAATGAGATAATTATGCTCAGG - Intronic
979924888 4:126549629-126549651 CCACATTGATAATAATGATAAGG + Intergenic
982380728 4:154744620-154744642 CCACTTTGACAATAACGCCCAGG - Exonic
982613899 4:157615763-157615785 CAACTTAGATAATAATGTTCAGG + Intergenic
983250404 4:165338836-165338858 ACAATTTTAGAAAAATGCTCAGG - Intronic
983607279 4:169602884-169602906 TCAATTTTATAAGAATGCTTTGG + Intronic
984707161 4:182855966-182855988 CCACTTCGATGATAAGGCTCGGG + Intergenic
985469579 5:31035-31057 CCAGTGTGAAAATAGTGCTCAGG - Intergenic
990523327 5:56600950-56600972 AAAATCTGATAAAAATGCTCTGG - Intronic
992974297 5:82097760-82097782 CCAATTTTACAATATTGCTTTGG - Intronic
994255209 5:97585201-97585223 ACAATTAGATAATAGTGCTAAGG + Intergenic
995453313 5:112326368-112326390 CCAGTTTGACAAAAAGGCTCTGG - Intronic
996617674 5:125460386-125460408 ACAATTTAATAATTCTGCTCAGG + Intergenic
999903727 5:156116167-156116189 CCATTTTCAAAATAATGATCTGG + Intronic
1000401727 5:160835844-160835866 CCAATTTGATTAAATTGTTCTGG + Intronic
1002120342 5:176998887-176998909 ATAATTTAAAAATAATGCTCAGG + Intronic
1003778587 6:9397704-9397726 CCAATTTAATAATCCTTCTCAGG - Intergenic
1004232316 6:13844733-13844755 TCAATTTGATAAAAATACTCAGG + Intergenic
1011986969 6:93459351-93459373 TCAATTTAATGATAATGCTTAGG - Intergenic
1012172923 6:96041977-96041999 ACAATTTGATGATAAAGTTCAGG - Intronic
1012411079 6:98957710-98957732 CCAATTTGTTTATACTGCCCTGG - Intergenic
1012575353 6:100789517-100789539 GATATTTGATAATAATTCTCAGG - Intronic
1014971304 6:127818706-127818728 AAAATTTAATAATAATGCTAAGG + Intronic
1023139677 7:37089368-37089390 ACAATTTAATACTACTGCTCTGG - Intronic
1028417084 7:90592388-90592410 CCACTTTAATAATTATACTCTGG + Intronic
1029173925 7:98650457-98650479 CAAATATGATTATAAAGCTCAGG - Intergenic
1030092470 7:105869659-105869681 CCAATTTGAAAATTGTGCTGGGG - Intronic
1031251160 7:119382572-119382594 CCAATTAGAAAATAATTTTCAGG - Intergenic
1031602067 7:123722216-123722238 TCTATTGGACAATAATGCTCTGG + Intronic
1032315941 7:130838583-130838605 CCATTTTAATAATTATGCTGGGG - Intergenic
1032836465 7:135679993-135680015 CTAATATAATAATAATGCTGTGG + Intronic
1034758699 7:153649990-153650012 TCAATTTGCTAATATTGCTCAGG - Intergenic
1037167629 8:15849879-15849901 CCACTTTGAGAGTGATGCTCCGG - Intergenic
1042850445 8:73211228-73211250 CCAAAATAATAATAATGCTGGGG - Intergenic
1043737055 8:83761611-83761633 CCAAATTGATCATAATGTTCTGG + Intergenic
1045166326 8:99609924-99609946 CTAATTTCATAATAATTCTAAGG - Intronic
1048537220 8:135308287-135308309 CAAATTTGTTAAGAATGCTTTGG + Intergenic
1050264566 9:3876481-3876503 CCAATATAATAATCATACTCAGG - Intronic
1051446595 9:17146446-17146468 CCAATGTGATAATATTGATGAGG + Intronic
1051487416 9:17623855-17623877 TCAAGTTGATAATAGTGCTGCGG - Intronic
1054746886 9:68863073-68863095 CCAAAATGTCAATAATGCTCAGG - Intronic
1203462861 Un_GL000220v1:58360-58382 CCAATTAATTAAAAATGCTCTGG - Intergenic
1203367515 Un_KI270442v1:271633-271655 CCATTTTGATTTTAATGATCTGG + Intergenic
1203656796 Un_KI270753v1:5725-5747 CCAATTGCATAATAATGTTAGGG + Intergenic
1186269269 X:7867152-7867174 CCAATTTCATAACAATATTCTGG + Intergenic
1188232114 X:27677316-27677338 CCTATTAGAAAATAATTCTCAGG - Intronic
1192068171 X:67909028-67909050 CCAATTGGCTAATTATCCTCTGG + Intergenic
1193868283 X:86764019-86764041 CCAACCTAATAATAATGTTCAGG + Intronic
1194819289 X:98486370-98486392 CCAAAGTGTTAATAATGCTAGGG - Intergenic
1195364161 X:104111638-104111660 TCAATGTGATAATAGTGCTGAGG - Intronic
1195673749 X:107490814-107490836 CCAATTTGAAAATCATGGACAGG - Intergenic
1199043893 X:143146587-143146609 CCAAAATGCTAATAATGATCTGG + Intergenic
1201634170 Y:16103964-16103986 CTAATTTGTTAATTATGCTAAGG + Intergenic