ID: 1118570251

View in Genome Browser
Species Human (GRCh38)
Location 14:67187749-67187771
Sequence CAGTCTGAGCAAAGGCACAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118570251_1118570254 2 Left 1118570251 14:67187749-67187771 CCTCTGTGCCTTTGCTCAGACTG No data
Right 1118570254 14:67187774-67187796 TAATCTTTCAGGATTTAGCTTGG No data
1118570251_1118570253 -9 Left 1118570251 14:67187749-67187771 CCTCTGTGCCTTTGCTCAGACTG No data
Right 1118570253 14:67187763-67187785 CTCAGACTGACTAATCTTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118570251 Original CRISPR CAGTCTGAGCAAAGGCACAG AGG (reversed) Intergenic
No off target data available for this crispr