ID: 1118571573

View in Genome Browser
Species Human (GRCh38)
Location 14:67200029-67200051
Sequence TCTGGACACCCAGGCTCTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 349
Summary {0: 1, 1: 1, 2: 3, 3: 40, 4: 304}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118571563_1118571573 8 Left 1118571563 14:67199998-67200020 CCATGGACCTCATGGTTTAGGAC 0: 1
1: 0
2: 2
3: 7
4: 98
Right 1118571573 14:67200029-67200051 TCTGGACACCCAGGCTCTGGGGG 0: 1
1: 1
2: 3
3: 40
4: 304
1118571564_1118571573 1 Left 1118571564 14:67200005-67200027 CCTCATGGTTTAGGACATCCCCA 0: 1
1: 1
2: 0
3: 7
4: 118
Right 1118571573 14:67200029-67200051 TCTGGACACCCAGGCTCTGGGGG 0: 1
1: 1
2: 3
3: 40
4: 304

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118571573 Original CRISPR TCTGGACACCCAGGCTCTGG GGG Intronic
900506553 1:3032313-3032335 TCTGAGCAGCCAGGCCCTGGTGG + Intergenic
900522027 1:3110420-3110442 TCTGCACACCCAGGACATGGGGG - Intronic
900522048 1:3110499-3110521 TCTGCACACCCAGGACATGGGGG - Intronic
900527390 1:3135894-3135916 TCTGCAGCCCCAGGCTCTGTAGG - Intronic
901958778 1:12808258-12808280 TCAGGACACAGAGGCCCTGGAGG - Intergenic
902800826 1:18828972-18828994 CCTGGACACACAGGCTCCCGGGG - Intergenic
903570158 1:24298215-24298237 AATGAACACCCAGCCTCTGGTGG + Intergenic
903621972 1:24704564-24704586 TCCAGACACCCAGTCTCTGTTGG - Intergenic
903735541 1:25528097-25528119 TCTGCAGCCCCAGGCCCTGGCGG + Intergenic
904051977 1:27645354-27645376 TGGGGGCACCCAGGCCCTGGGGG - Intergenic
904620194 1:31770563-31770585 GCTGGACACCTAGGTTTTGGGGG + Intergenic
905232358 1:36522143-36522165 TCTGGAGACCCAGTCTGAGGGGG - Intergenic
905582827 1:39095157-39095179 TCTGAACAGCCAGGCTTTGCTGG - Intronic
906697492 1:47833157-47833179 ACTGGAATCCCAGGCTCTGTGGG + Intronic
907282752 1:53361824-53361846 TAGGGACACCCAGGGTCTGTAGG + Intergenic
907334850 1:53693389-53693411 TCTGGACACCCAGCCCTCGGGGG + Intronic
908208322 1:61873805-61873827 GCTGGAGACCCATGCACTGGGGG + Intronic
910859786 1:91732191-91732213 TGTGGAAACTGAGGCTCTGGTGG + Intronic
911092913 1:94031884-94031906 CCTGGGCACTCTGGCTCTGGGGG + Exonic
912271077 1:108209547-108209569 GCTTCAAACCCAGGCTCTGGTGG + Intergenic
913259959 1:116988849-116988871 TCTAGTCACTCAGGCCCTGGTGG - Exonic
914678746 1:149923936-149923958 GCTGGACCCCCAGGCTCTGGGGG - Exonic
915605262 1:156946426-156946448 TCAGGACACACAGGTGCTGGTGG + Intronic
915798830 1:158766610-158766632 TCTGGACACCCTGGAGATGGGGG + Exonic
916282756 1:163070876-163070898 TCTGGAGCCTCAGGCACTGGTGG - Intronic
917511052 1:175669644-175669666 TCTGGAAACCCTGGCTCGGCTGG - Intronic
919813744 1:201424977-201424999 TCTGGAAGGCCAGGCCCTGGTGG - Intronic
919921660 1:202169774-202169796 TCTGGAGACACAGGGGCTGGAGG - Intergenic
920669655 1:207993600-207993622 TCTGGAAGCCCAGGCTCTGAAGG + Intergenic
920747192 1:208640104-208640126 TCTGGACACCGAGTCCATGGTGG - Intergenic
921075309 1:211695859-211695881 TGAGGAAACCCAGGCTCTAGAGG + Intergenic
922757947 1:228106885-228106907 TCTGGACACCCTGTCTCCTGAGG - Exonic
923047748 1:230367975-230367997 GCTGGACACCAAGGAGCTGGGGG + Intronic
923228450 1:231961235-231961257 TCTGAACACACAGGCCCTGTGGG - Intronic
923417974 1:233783619-233783641 ACTGACCACCCAGGTTCTGGTGG + Intergenic
1063954377 10:11252749-11252771 TTTGGACAACCTGGCTCTGTGGG - Intronic
1064304932 10:14157057-14157079 CCTGAACCCCCAGGCTCTGTGGG - Intronic
1065925861 10:30433693-30433715 TCTGGAGTCCCAGGGTCCGGCGG - Intergenic
1066192757 10:33070951-33070973 TCTGGACTCTGAGGCTCTGGAGG - Intergenic
1066993539 10:42539810-42539832 GCTTGAAACCCAGGCCCTGGTGG + Intergenic
1067279504 10:44860739-44860761 CCTGGGCAGCCTGGCTCTGGGGG - Intergenic
1067685502 10:48464256-48464278 TCTGCACCCCTAGGGTCTGGTGG - Intronic
1069814857 10:71187226-71187248 CCCGGACATCCAGGCACTGGGGG + Intergenic
1070529552 10:77324788-77324810 GCTGGAAAGCCAGGCTATGGTGG + Intronic
1070753565 10:78977782-78977804 GCTGGAAACCCAGGGTCTGGAGG - Intergenic
1070766418 10:79059141-79059163 TCTGGACTCCCATCCTCTTGGGG - Intergenic
1071480297 10:86060444-86060466 TGTGGGCACCCAGACTTTGGAGG + Intronic
1072582038 10:96748008-96748030 GCTGAAGACCCAGGCTCTGTCGG + Intergenic
1074982724 10:118632774-118632796 TGGGGGCAGCCAGGCTCTGGTGG - Intergenic
1076032603 10:127172341-127172363 TCTGGAACAACAGGCTCTGGAGG - Intronic
1076636615 10:131885353-131885375 TGTGGACACCCAGGGACTTGGGG - Intergenic
1076662522 10:132065018-132065040 CCTGCACGCCCAGGTTCTGGGGG - Intergenic
1077081253 11:725682-725704 TCCCCACACCCAGGCTCTGCGGG - Intronic
1077452259 11:2655475-2655497 TCTGGATATCCAGGCTCTGCAGG - Intronic
1077490723 11:2859712-2859734 GCTGGAAACCCAGGCGCAGGAGG + Intergenic
1078491222 11:11770726-11770748 TCTGGACACCATGGATCTTGAGG - Intergenic
1079430792 11:20387180-20387202 TCTGGGCTCCCAGGTCCTGGAGG - Intergenic
1080502448 11:32883732-32883754 CCTGGACACCAAGGCTTAGGTGG - Intergenic
1080698540 11:34624230-34624252 TCTAGACACCCAGGCTGCAGTGG - Intronic
1083179016 11:60972394-60972416 TCTGGACAACCAGGCGCTGATGG + Intronic
1083632391 11:64102478-64102500 TCTGGAAGCCCAGGCCATGGCGG + Intronic
1084251666 11:67904041-67904063 TCTTGACGCCCAGGCTTGGGTGG - Intergenic
1084399306 11:68934483-68934505 TTTGCACATCCAGGCTCTGGTGG + Exonic
1084546586 11:69817963-69817985 TCTGCACCCCCAGGCCCGGGCGG + Intronic
1084821173 11:71691989-71692011 TCTTGACGCCCAGGCTTGGGTGG + Intergenic
1085284235 11:75349837-75349859 GCTGGAGGCCCAGGCTTTGGGGG - Intronic
1086490456 11:87353664-87353686 CCTCGACACCTAGGCTCTGTGGG + Intergenic
1089341505 11:117761141-117761163 TCTGAACACCCAGCCTCCAGAGG + Intronic
1089366409 11:117923573-117923595 ACTGCAAGCCCAGGCTCTGGGGG - Intronic
1090430157 11:126639165-126639187 TCTGGAAACTTAAGCTCTGGAGG + Intronic
1090840937 11:130487082-130487104 TCTGGACACGCAGGCCCGGCTGG + Intergenic
1091190636 11:133692918-133692940 TGTGGAAACCGAGGCTCCGGAGG + Intergenic
1091570507 12:1681340-1681362 TATGGCCAGCCAGGCTCTGAAGG + Intergenic
1091587135 12:1822775-1822797 TCTGGGCACCCAGGCCCTCTAGG - Intronic
1091599881 12:1911715-1911737 CCTGGAGCCCCAGCCTCTGGGGG + Intronic
1091635988 12:2197051-2197073 CGTGGAAAGCCAGGCTCTGGAGG - Intronic
1091976812 12:4832157-4832179 TGATGACACCCAGGCTCTCGGGG - Intronic
1092421936 12:8338829-8338851 TCTTGACGCCCAGGCTTGGGTGG - Intergenic
1092927697 12:13287126-13287148 CCTGGACACCAAAGCTCGGGTGG + Intergenic
1094046191 12:26169631-26169653 TCAGGACAGCCAGGCTATGGGGG + Intronic
1095085435 12:38054109-38054131 TCCGCACTCCCATGCTCTGGTGG - Intergenic
1095710600 12:45284194-45284216 TCTGGACACACAGGCCTTGCTGG - Intronic
1096004905 12:48161636-48161658 TCTGGACACCCAGATTCAGGAGG + Intronic
1096153687 12:49330394-49330416 TCTGGGGGCCCAGGCTCTGCCGG - Exonic
1096717097 12:53498216-53498238 TCTGGACAGGAAGGCTCAGGGGG + Intronic
1097809832 12:64006457-64006479 TCTGGAGAGGCAGGCTGTGGAGG + Intronic
1101854180 12:108428368-108428390 GCTGCACTCCGAGGCTCTGGGGG - Intergenic
1101912008 12:108867060-108867082 ACTGGACACCCTGGCCCAGGTGG - Intronic
1103740003 12:123084576-123084598 TCTCTTCACCCATGCTCTGGGGG - Intronic
1103943912 12:124516015-124516037 AGTGGACACCAAGGCCCTGGGGG + Intronic
1104726913 12:131083846-131083868 TCTCGCCACCCTGTCTCTGGCGG + Intronic
1106200901 13:27536573-27536595 GCTGAACACCCAGGCCCTGGAGG + Intergenic
1106272264 13:28166395-28166417 TCTGGACACACTGGGACTGGGGG + Intronic
1106836531 13:33641101-33641123 TCTAGACACACAGGCTTTGCTGG - Intergenic
1106929791 13:34651965-34651987 CCTGGACATCCAGGCACTGTTGG + Intergenic
1112479022 13:99756979-99757001 CCTTGACCCCCAGGCTCAGGCGG + Intronic
1114075982 14:19161380-19161402 GGTTGACACCCAGGCTCAGGTGG - Intergenic
1114086181 14:19238191-19238213 GGTTGACACCCAGGCTCAGGTGG + Intergenic
1118287316 14:64487648-64487670 TCCTGCCACCCAGGCCCTGGAGG - Exonic
1118571573 14:67200029-67200051 TCTGGACACCCAGGCTCTGGGGG + Intronic
1118981868 14:70723668-70723690 TGTGGAAACCAAGGCTCTGATGG - Intronic
1119306286 14:73610626-73610648 TCCAGACCCCCAGGATCTGGAGG - Intergenic
1119328526 14:73776763-73776785 TCTGAAGAGCAAGGCTCTGGAGG - Intronic
1120669837 14:87350933-87350955 ACTGGACAGCCAGGCTCCAGGGG + Intergenic
1122259016 14:100501613-100501635 TGTGGACACTCAGGATGTGGGGG + Intronic
1122804215 14:104248445-104248467 CAAGGACACCCAGGCTCTGCAGG - Intergenic
1122904890 14:104797082-104797104 ACCAGACGCCCAGGCTCTGGGGG - Intergenic
1123025533 14:105421928-105421950 CCTGGACTCCTAGGCTGTGGCGG + Intronic
1202897718 14_GL000194v1_random:19810-19832 GGTTGACACCCAGGCTCAGGTGG + Intergenic
1125727329 15:41874750-41874772 TCTGGACACCCCGGTCCTGTGGG + Intronic
1128338262 15:66802396-66802418 GCGGCACACACAGGCTCTGGGGG + Intergenic
1129256447 15:74336654-74336676 TCAGGAGGCCCAGGTTCTGGGGG + Intergenic
1129523601 15:76200655-76200677 TCAGGACCCCCAGGCCCTGTGGG - Intronic
1130703648 15:86211436-86211458 TCTGTAGACCCCAGCTCTGGGGG - Intronic
1131147761 15:90025176-90025198 CCCGGTCACCCTGGCTCTGGAGG - Intronic
1132576195 16:665580-665602 TTTGGACAGCCCGGCCCTGGGGG + Intronic
1132714592 16:1284425-1284447 TCTGGACACCCCTGCTCTGCCGG + Intergenic
1134191024 16:12121352-12121374 TCTCGGCTCCCAGGCTCTGGGGG - Intronic
1138106811 16:54291425-54291447 TCCGGATTCCCGGGCTCTGGGGG + Intergenic
1138269032 16:55681432-55681454 TCGGGTCACACAGGATCTGGTGG + Intronic
1138383069 16:56617179-56617201 TCCGGGAACCCAGCCTCTGGTGG - Intergenic
1138492108 16:57382798-57382820 TAAGGACGCCCAGCCTCTGGGGG - Exonic
1138853172 16:60655026-60655048 CATGGACACTCATGCTCTGGCGG - Intergenic
1139224226 16:65218486-65218508 AGTGGAGACCCAGGCCCTGGTGG - Intergenic
1139295296 16:65895340-65895362 GCTGGACAGCCAGGCTCCAGAGG + Intergenic
1139551887 16:67678083-67678105 TCTGTTCACACAGGCTCAGGAGG + Intronic
1140065912 16:71611095-71611117 TCTGGTCACCCAGGCTGAGTCGG + Intergenic
1141857131 16:86691043-86691065 TCTGGAAACTCTTGCTCTGGAGG + Intergenic
1141881867 16:86865636-86865658 GCAGGACACCCAGACTGTGGGGG + Intergenic
1142192331 16:88723631-88723653 TCTGACCACCCAGGTTCTGGTGG - Intronic
1142549620 17:730559-730581 TCTGGAAACACTGGCGCTGGAGG + Intergenic
1142890523 17:2940029-2940051 TCTCGGGACCCAGGCCCTGGCGG + Intronic
1144018513 17:11220097-11220119 TCTGGGCACCCCAGCTCTGCAGG - Intergenic
1144482520 17:15639597-15639619 TCTGGACAACAGGGCTCCGGAGG - Intronic
1144734676 17:17548383-17548405 TCTGGAGACCAGGGGTCTGGGGG + Intronic
1145901026 17:28490639-28490661 TCTGGGCACCCAGTCCCTGAAGG + Intronic
1147162774 17:38577762-38577784 TCAGGACCCCGAGGTTCTGGGGG + Intronic
1147560146 17:41503749-41503771 ACTGGACACCCATGCCCTAGAGG - Intronic
1148776936 17:50101331-50101353 TCTGTACACCCAGGCCCATGAGG + Intronic
1148818377 17:50346483-50346505 CCTGGAGACCCGGGCCCTGGTGG + Intronic
1151577305 17:74959163-74959185 TCTGGGCCCTCTGGCTCTGGAGG - Intronic
1151828907 17:76538300-76538322 TCTGGACGCCCAGGCTCTGGGGG + Intronic
1152065224 17:78108688-78108710 CCTGGACACCCAGGCCCACGAGG - Exonic
1152309928 17:79543914-79543936 TGTGGGCACCCTGGCTCTGGGGG - Intergenic
1152633684 17:81421779-81421801 TCTGGAAATCCTGGCTCTGGCGG - Intronic
1152904066 17:82960921-82960943 CCTTGAGACCCAGGGTCTGGTGG - Intronic
1153651039 18:7240495-7240517 CCTGGACAGCAAGGCTCAGGGGG + Intergenic
1153952183 18:10067122-10067144 CCAGGACATCCAGGCTCTGAAGG - Intergenic
1154293605 18:13131324-13131346 TCTGGGCACCAAGGCTTTGGGGG - Intergenic
1155095299 18:22549643-22549665 TGTGGGCACAAAGGCTCTGGAGG - Intergenic
1156460721 18:37319956-37319978 GCTGGACACCCCAGCCCTGGCGG + Intronic
1157299305 18:46467991-46468013 TCCGGGCACCCAGGGTGTGGAGG + Intergenic
1157683993 18:49628398-49628420 CCTGGAGACCAAGCCTCTGGTGG - Intergenic
1159952489 18:74495853-74495875 TCTGATCTCCCAGGCTCCGGAGG - Intronic
1160403048 18:78625011-78625033 GTCTGACACCCAGGCTCTGGGGG + Intergenic
1160442549 18:78903443-78903465 TCTGGAGACCCAGGATCAGATGG - Intergenic
1160707187 19:535178-535200 TGTGGTCACCCAGGCCCTGGAGG - Intronic
1160820378 19:1055019-1055041 TGTGGGCACCCAGCTTCTGGGGG - Intronic
1161314435 19:3611284-3611306 TGTGGACACCCACACTCTGCAGG - Exonic
1161332638 19:3695574-3695596 CTGGGACACCCAGGCTGTGGTGG + Intronic
1161346493 19:3771028-3771050 TCTGCACACCCCAGCCCTGGGGG + Intronic
1162131249 19:8527351-8527373 AGTGGACATCCAGGCTCTGCGGG - Exonic
1162342935 19:10102719-10102741 GCTCCACTCCCAGGCTCTGGGGG - Exonic
1165336380 19:35172965-35172987 TCTGGACGCCAAGGCTCGAGTGG - Intergenic
1166253620 19:41587267-41587289 TCTCTTCACCCAGGCCCTGGAGG + Intronic
1166381156 19:42356076-42356098 TGCACACACCCAGGCTCTGGGGG - Exonic
1166382411 19:42361954-42361976 TGGGGACAGCCAGGCTCAGGAGG + Intronic
1166999746 19:46738879-46738901 TCTGCCCTCCCAGGCTCAGGTGG - Exonic
1167467340 19:49657306-49657328 TCTGGTCACCCAGGGGATGGAGG - Intronic
1167820527 19:51923423-51923445 CCTGGACACCCAGGCTCAAGTGG + Intronic
925351780 2:3206176-3206198 GCGGGACACCCAGGCTCTTGTGG + Intronic
927760793 2:25751891-25751913 CCTGTAGACCCAGGCTCAGGTGG - Intronic
927916735 2:26941907-26941929 TCAAGTCAACCAGGCTCTGGGGG - Intronic
928911637 2:36427772-36427794 TCTGTACACCAAGGGTCTTGGGG - Intronic
929943035 2:46349276-46349298 GATGGACAGCCAGGCTCAGGAGG - Intronic
929943636 2:46353821-46353843 TCTGCACACCCTGGTTCAGGCGG - Intronic
931691810 2:64840007-64840029 TATGGCCACCCTGGCTCAGGAGG - Intergenic
937378142 2:121352008-121352030 CCGGGCCACCCATGCTCTGGTGG + Intronic
937419589 2:121742501-121742523 GCGGCTCACCCAGGCTCTGGTGG + Intronic
937540157 2:122939974-122939996 TCTGGCAGGCCAGGCTCTGGAGG + Intergenic
938140041 2:128787685-128787707 TCTAGACACCCCGCCTCAGGAGG + Intergenic
938289905 2:130143616-130143638 TCTGGAATCCCTGGCTATGGCGG + Intronic
938490575 2:131758901-131758923 GGTTGACACCCAGGCTCAGGTGG - Intronic
939055583 2:137360754-137360776 TCTGTACACCCCACCTCTGGGGG + Intronic
939547297 2:143569271-143569293 TCTGGAAAATCAGGCTCTGGTGG + Intronic
941276544 2:163497717-163497739 ACTTGAAACCCAGGCCCTGGTGG - Intergenic
944138888 2:196433321-196433343 TCTGGGCGGCAAGGCTCTGGAGG + Exonic
947570355 2:231228802-231228824 TTTGGACCCCCAGGCAATGGGGG + Intronic
947665408 2:231902358-231902380 TCTGGACAGCCAGGCTGTCGTGG + Intergenic
947802190 2:232936591-232936613 TCTGGACACCAAGGCACAGGTGG + Intronic
948790687 2:240375153-240375175 TCTCGACACCCAGGCTGGGGAGG - Intergenic
949078899 2:242080655-242080677 CCTGGACACCCAGCCACTAGTGG + Intergenic
1169880616 20:10342339-10342361 TGTGCACAGCCAGGCTGTGGTGG - Intergenic
1170048801 20:12116549-12116571 TCTGGATGCCCAAGCTCTGCTGG - Intergenic
1170314813 20:15031069-15031091 TGTGCACAGCCAGGCTGTGGTGG + Intronic
1171096393 20:22336231-22336253 ACTTGACAGCCAGGTTCTGGGGG - Intergenic
1171972152 20:31571115-31571137 TCTAGACTCGCAGGCTCTGCGGG - Exonic
1171977497 20:31604863-31604885 TCCGGAAACCCAGGCTCTCTGGG + Intergenic
1172103212 20:32498144-32498166 TCTGGAGAGCCAGTGTCTGGTGG - Intronic
1172879952 20:38193535-38193557 TCTTAACCCCCATGCTCTGGTGG + Intergenic
1174291164 20:49509627-49509649 TCTGCACACCCAGGTTCAGCTGG - Intronic
1175312366 20:58020616-58020638 GCTGGACAGCCAGGGACTGGGGG - Intergenic
1175599831 20:60264248-60264270 TCTGGCCTCCCAGGCCCGGGAGG + Intergenic
1176197570 20:63844475-63844497 TCTGAGCACCCTGGGTCTGGGGG - Intergenic
1176617402 21:9035799-9035821 GGTTGACACCCAGGCTCAGGTGG + Intergenic
1176707738 21:10127870-10127892 GGTTGACACCCAGGCTCAGGTGG - Intergenic
1176899037 21:14417474-14417496 TCTGGCCACTCAGGTCCTGGAGG - Intergenic
1177366927 21:20151527-20151549 GCTGGGCACCCAGGCTGTGTGGG + Intergenic
1178582963 21:33851276-33851298 TATGGAGACCCAGCCTCAGGAGG + Intronic
1179408227 21:41142689-41142711 TGTGGCCACCTGGGCTCTGGAGG - Intergenic
1179981885 21:44900069-44900091 GTGGGACACCCAGGCTCTGTTGG - Intronic
1180291682 22:10854545-10854567 GGTTGACACCCAGGCTCAGGTGG - Intergenic
1180291786 22:10855002-10855024 GGTTGACACCCAGGCTCAGGTGG - Intergenic
1180494487 22:15883967-15883989 GGTTGACACCCAGGCTCAGGTGG - Intergenic
1180494590 22:15884424-15884446 GGTTGACACCCAGGCTCAGGTGG - Intergenic
1180883830 22:19225483-19225505 GCTGGGCACGCAGGCCCTGGTGG - Exonic
1181009756 22:20033268-20033290 TCCGGACAGCCTGGCACTGGAGG - Intronic
1182101198 22:27658779-27658801 CCAGGAGACCCAGGCTCTGCTGG + Intergenic
1182444660 22:30383104-30383126 TCTGGACTCCCAGAGGCTGGAGG + Intronic
1182850099 22:33466399-33466421 CTTGAACACCCAGGCTCTTGTGG + Intronic
1182857479 22:33530714-33530736 CCTGGAGACTCAGGCTCTGCAGG - Intronic
1183184725 22:36285418-36285440 TCTGGACCCCAAGGGTTTGGTGG - Intronic
1184310775 22:43640959-43640981 TCTGGTCACCCAGGCTGGGGAGG - Intronic
1184386658 22:44180456-44180478 TCTGGACACAGTGGTTCTGGTGG - Intronic
1203293201 22_KI270736v1_random:15321-15343 TGTGGAAGTCCAGGCTCTGGGGG + Intergenic
949809019 3:7985939-7985961 TCTGGCCACTCAGGCTATGGAGG - Intergenic
950440138 3:13005720-13005742 TCTGGGCAGCCTGGCTCTGGAGG + Intronic
952495620 3:33913559-33913581 TCTGGCCCACCAGGCCCTGGAGG + Intergenic
952879079 3:37971740-37971762 TGTGGACACCCAGCTTCAGGTGG - Intronic
953679837 3:45030867-45030889 TCTGGACACCCTGGCCCAGGAGG + Exonic
953795889 3:45985619-45985641 TCTGCACACCCAGGCTGAGTTGG - Intronic
953927906 3:46991694-46991716 TATGGGCTCCCAGGCTCTTGGGG + Intronic
954892022 3:53939430-53939452 TCTGAACATCCAGCCTCCGGGGG + Intergenic
955795899 3:62636742-62636764 TGTGGATACCCAGGCTGTAGAGG + Intronic
955895401 3:63694447-63694469 TCTGTACACCCCACCTCTGGGGG + Intergenic
958161268 3:89818907-89818929 TCTTGACACCCAAAGTCTGGAGG + Intergenic
958764804 3:98354039-98354061 TCTGGGCAACCTGGCTCTGATGG + Exonic
959444972 3:106427676-106427698 ACTGGACAACCAGGCTTAGGAGG + Intergenic
959882167 3:111456203-111456225 ACTGGACAACCAGGTTCTAGTGG - Intronic
961468937 3:127099393-127099415 TCTGCAAACCCAAGCTCTGGTGG + Intergenic
961689536 3:128658616-128658638 CCTGTAGTCCCAGGCTCTGGAGG + Intronic
961899677 3:130198354-130198376 TCTTGACGCCCAGGCTTGGGTGG - Intergenic
966916557 3:184587504-184587526 GCTGGGCACCCAGGCACTGAAGG + Intronic
968169682 3:196500029-196500051 ACTGGACACCCACGCACTGTTGG + Intronic
968641591 4:1717578-1717600 ACAGGTCGCCCAGGCTCTGGTGG + Exonic
968959381 4:3735236-3735258 GCTAGACCCCCAGGCTCTAGGGG + Intergenic
969530596 4:7728294-7728316 TCTGGACAGCCTGGCTCTGACGG - Intronic
969701849 4:8771953-8771975 TGTGGACTCACAGGCTGTGGAGG - Intergenic
969743711 4:9053384-9053406 TCTTGACGCCCAGGCTTGGGTGG + Intergenic
969933960 4:10662991-10663013 ACTGGCCACCCAGGCTCTTTTGG - Intronic
970447922 4:16139665-16139687 TCTGCCCAGCCAGTCTCTGGGGG - Intergenic
971606080 4:28660023-28660045 TCTGGAAATGCAGGCTCTGTTGG - Intergenic
971884261 4:32423442-32423464 TCTGGTCATTCAGACTCTGGTGG + Intergenic
973213302 4:47639860-47639882 TCTGGAGAGCCAGGCTATGCCGG - Intronic
976128660 4:81860443-81860465 TCTAGACACCCTGGCTCAGAAGG + Intronic
976232841 4:82863561-82863583 TTTGGAGACCCAGCCTCAGGAGG + Intronic
977625008 4:99180439-99180461 GCTAGACACCCTGGCTCTGTGGG - Intergenic
978901064 4:113950025-113950047 TGTAGAAGCCCAGGCTCTGGGGG + Intronic
980956076 4:139430565-139430587 TCTGTTCACACAGGCTCAGGAGG + Intergenic
981250969 4:142600139-142600161 TCTAGACACCCAGATTCAGGAGG + Intronic
984760427 4:183358345-183358367 TGTGGGTACCCACGCTCTGGAGG - Intergenic
985084621 4:186299606-186299628 TCTGCACCCCCAGGCTTTGGGGG - Intergenic
988605998 5:32678764-32678786 ACTGGACACCAAGGCTGAGGAGG + Intergenic
991536759 5:67677630-67677652 TCAGGAAACCCAAGCTCTGTTGG + Intergenic
995128200 5:108601040-108601062 GCAGGACACACAGGCTATGGTGG + Intergenic
995557059 5:113340656-113340678 TCTGCACATCCGGGCTCTGGAGG + Exonic
998298405 5:140994181-140994203 TCTGGACCAACAGGCCCTGGTGG - Intronic
999689440 5:154134101-154134123 GCTGGAGACCCAGGCTCAGCTGG + Intronic
1001936376 5:175708769-175708791 CTTAGACCCCCAGGCTCTGGGGG + Intergenic
1002047562 5:176550414-176550436 TCCGGGCACCCAGGCTCGGCTGG + Intronic
1002135243 5:177103742-177103764 TGTGGACACTGAGGCTCTGAAGG + Intergenic
1002209117 5:177585524-177585546 CCAGAACACCCAGGCCCTGGAGG + Intergenic
1002416573 5:179123940-179123962 CCTGGACGCCCAGGCTCTGGTGG + Intronic
1003542182 6:7027381-7027403 TCTGTAGACCCCGCCTCTGGGGG + Intergenic
1003835124 6:10063103-10063125 TCTGACAACACAGGCTCTGGAGG + Intronic
1004488092 6:16087095-16087117 TCTGGACAGCCAGGCTCCAATGG - Intergenic
1006435056 6:34021734-34021756 TCTGGAGACCCAGGGCTTGGGGG - Intronic
1006816635 6:36855609-36855631 TCTGGCAACCTAGGCACTGGGGG + Exonic
1017628325 6:156370640-156370662 TGGGGACAGCCAGGCTCTGGAGG - Intergenic
1018881328 6:167884530-167884552 CCTAGTCACCCAGGCTCTGGTGG - Intronic
1019367901 7:644682-644704 TCCAGCCACCCAGGCCCTGGTGG - Intronic
1019577441 7:1744339-1744361 TCAGGACACCCAGGCCCATGGGG + Exonic
1019624634 7:2009719-2009741 GGTGGACGCCCAGGCCCTGGGGG + Intronic
1019713459 7:2527801-2527823 GCTGGACAGCCAGCCACTGGGGG - Exonic
1019884335 7:3891033-3891055 TTTTGGGACCCAGGCTCTGGTGG + Intronic
1021478646 7:21091386-21091408 TGAGGACACCCAGCCTCTGATGG - Intergenic
1022048513 7:26643174-26643196 TCTGGACAGACAGGCCCTGCTGG + Intronic
1022347308 7:29528756-29528778 TCTGTAGACCCAACCTCTGGGGG + Intergenic
1022687796 7:32612868-32612890 TCTGGGCACACAGCCTATGGGGG - Intergenic
1024002902 7:45202682-45202704 TCTGGTCACCCAGGCCCTGCAGG + Intergenic
1024579602 7:50791526-50791548 TCTGAAAACCAAGGCTCAGGAGG - Intronic
1026824083 7:73570515-73570537 TCAGGGCACCCAGGCTCTTCAGG + Exonic
1027164941 7:75827734-75827756 GCAGGTCACCCTGGCTCTGGGGG - Intergenic
1027746507 7:82081830-82081852 ACTGTGCACCCAGCCTCTGGTGG + Intronic
1027829279 7:83156324-83156346 GCTGGACGCCCAGGGTCCGGGGG + Exonic
1028430007 7:90735930-90735952 GCTTGAAACCCAGGCCCTGGTGG + Intronic
1028754179 7:94416474-94416496 TCTGGACCCCCAGGGCCTGATGG + Exonic
1029069626 7:97884512-97884534 TCTTGACGCCCAGGCTTGGGTGG - Intergenic
1029161055 7:98552213-98552235 TCTGGACACCAAGGCTCAGGTGG + Intergenic
1029216960 7:98957510-98957532 CCTGGTCACCCGGGCCCTGGAGG - Intronic
1029601133 7:101564023-101564045 TCTGGGCACCCAGGCAGTGAGGG - Intergenic
1032533273 7:132639190-132639212 TCTGGGCACCCAGGATATGGAGG - Intronic
1033472383 7:141661709-141661731 TCTGGACACGAATTCTCTGGAGG - Exonic
1033663889 7:143423203-143423225 TCTGGACACACAAGCTTTCGTGG - Intergenic
1035332101 7:158103038-158103060 TCTGGACACCCAGGCCTTACTGG - Intronic
1035664487 8:1370751-1370773 ACTCGGCACCCAGGCTCTGAGGG + Intergenic
1036248919 8:7145153-7145175 TCTTGACGCCCAGGCTTGGGTGG + Intergenic
1036885329 8:12547822-12547844 TCTTGACGCCCAGGCTTGGGTGG - Intergenic
1037446514 8:18971255-18971277 GCCGGACACCCAGGCTCAGGCGG + Intronic
1037624116 8:20592819-20592841 GCTGGACAGCCAGGCTCCAGAGG - Intergenic
1038224809 8:25645852-25645874 GCGGGACACCCAAGCTGTGGAGG + Intergenic
1039488740 8:37931776-37931798 TCTGGACACCAAGGCTTAGGGGG - Intergenic
1040038738 8:42896377-42896399 TCTGGCCGCCGAGGCTCTGCGGG - Exonic
1040709939 8:50175960-50175982 TGAGGACACCCAGGCTCTCAGGG - Intronic
1040877995 8:52173413-52173435 CCTGGACAGACAGGCACTGGGGG - Intronic
1043841140 8:85106251-85106273 TTTAGACACCCAGGCACAGGAGG - Intergenic
1043851691 8:85223616-85223638 TTTGGACACCTAGGCTCTGTAGG + Intronic
1047851775 8:128865040-128865062 TCTGGACAGACAGGCCTTGGTGG + Intergenic
1049578629 8:143400893-143400915 GCTGCACACCCAGGCCCTGGAGG - Intergenic
1049594946 8:143479015-143479037 CCTGGGCTCCCAGGCTATGGTGG - Intronic
1049744736 8:144258451-144258473 TCCGGACACCCAGACGCTGCTGG - Intronic
1052860824 9:33436842-33436864 TCTGGGCACCTAGGCTGTGGAGG - Intergenic
1052883964 9:33625297-33625319 TCTGGACGCTCAGGCTGTGTCGG - Intergenic
1053554080 9:39116309-39116331 TCTGAACAGCCAGGAGCTGGAGG + Intronic
1053644936 9:40114607-40114629 GGTTGACACCCAGGCTCGGGTGG - Intergenic
1053761048 9:41350244-41350266 GGTTGACACCCAGGCTCAGGTGG + Intergenic
1053818183 9:41936434-41936456 TCTGAACAGCCAGGAGCTGGAGG + Intronic
1054108442 9:61080093-61080115 TCTGAACAGCCAGGAGCTGGAGG + Intergenic
1054612415 9:67251032-67251054 TCTGAACAGCCAGGAGCTGGAGG - Intergenic
1057271846 9:93655989-93656011 TCTCCACACTCAGGCTGTGGAGG - Exonic
1060479689 9:124011075-124011097 TCTCGCCACTCAGGCTCTGCCGG + Intronic
1060665549 9:125430194-125430216 TCTGGTCACCCGGGCACTAGAGG + Intergenic
1061265130 9:129500448-129500470 TCGGAACACCCAGGCTCTGCCGG - Intergenic
1061295394 9:129674222-129674244 TGTGCCCAGCCAGGCTCTGGGGG + Intronic
1061596805 9:131635794-131635816 TGTGGAGACTCAGGCTCAGGTGG - Intronic
1061876775 9:133547918-133547940 TCTGGAAATGGAGGCTCTGGTGG + Intronic
1062094335 9:134695207-134695229 TCAGGACACCCAGGGTTGGGTGG + Intronic
1062330990 9:136044890-136044912 GCTGAACACCCAGGCTTGGGTGG - Intronic
1202792483 9_KI270719v1_random:96750-96772 GGTTGACACCCAGGCTCAGGTGG - Intergenic
1203656065 Un_KI270752v1:25920-25942 GCTGGAGAGCCAAGCTCTGGAGG - Intergenic
1186514547 X:10156826-10156848 TCTGGACACGAATGCTCCGGGGG + Intergenic
1186748176 X:12592157-12592179 TCTGGACAGACAGGCCTTGGTGG + Intronic
1188117575 X:26263875-26263897 GCTGGACAGCCAGGCTCCAGAGG - Intergenic
1194115233 X:89888584-89888606 TCTAGACACCCTGGGTCTGAAGG - Intergenic
1195687213 X:107597925-107597947 TCTGGACAGCCCGGCGCTTGGGG - Exonic
1200468024 Y:3545723-3545745 TCTAGACACCCTGGGTCTGAAGG - Intergenic
1200827633 Y:7660326-7660348 TCTGGAGACTCAGGCCCTGCTGG - Intergenic
1201010782 Y:9547120-9547142 CCTGCACCCCTAGGCTCTGGGGG + Intergenic
1201150798 Y:11094636-11094658 GGTTGACACCCAGGCTCAGGTGG + Intergenic