ID: 1118571718

View in Genome Browser
Species Human (GRCh38)
Location 14:67200915-67200937
Sequence GGTGGGGTTGTGCATCTTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 160}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118571718_1118571725 27 Left 1118571718 14:67200915-67200937 CCTTCAAGATGCACAACCCCACC 0: 1
1: 0
2: 0
3: 14
4: 160
Right 1118571725 14:67200965-67200987 ACCAAGATTCCTGACTGAACAGG 0: 1
1: 0
2: 0
3: 10
4: 120
1118571718_1118571723 -5 Left 1118571718 14:67200915-67200937 CCTTCAAGATGCACAACCCCACC 0: 1
1: 0
2: 0
3: 14
4: 160
Right 1118571723 14:67200933-67200955 CCACCTGGTTAGCATGTCTTTGG 0: 1
1: 0
2: 1
3: 8
4: 89

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118571718 Original CRISPR GGTGGGGTTGTGCATCTTGA AGG (reversed) Intronic
900529916 1:3148118-3148140 GGTGTGGTTGGGCATCAGGACGG + Intronic
902941336 1:19801944-19801966 GGTGGGGTTCTAGATGTTGAGGG + Intergenic
905013694 1:34763047-34763069 GATGGGGTGGGGCATCTTCAAGG - Exonic
905350479 1:37342860-37342882 GGTGTGGTTATGCATTTTGAAGG - Intergenic
908430548 1:64052614-64052636 GCTGTGGTTGAGCATCTTTAAGG - Intronic
916368515 1:164061658-164061680 GGTGGGGTGGTGCATGTTGGTGG - Intergenic
916513277 1:165492541-165492563 GGAGGCTTTGAGCATCTTGAGGG - Intergenic
916764304 1:167845475-167845497 GGAGTGGGTGTGGATCTTGAGGG - Intronic
918188248 1:182146578-182146600 GGTGTGGTTGTGTACCCTGAGGG - Intergenic
919763407 1:201112141-201112163 GGGGGGGGTGTGCGTCATGAGGG - Intronic
920061434 1:203229546-203229568 GGTGGGGATGTGGATGTTCAGGG - Intronic
920539129 1:206764260-206764282 GGTGGGAGTGTGCATGATGATGG + Intergenic
922054227 1:222024945-222024967 GGTGGTGTTTTGCCTCCTGATGG + Intergenic
922676103 1:227551375-227551397 CTTGGGGTTGTTCTTCTTGAGGG - Intergenic
923223996 1:231922585-231922607 TGTGGGGTGGTGCTTCTGGATGG + Intronic
924299683 1:242624959-242624981 GGTCTGGATGTGCATCTAGAAGG + Intergenic
1063613102 10:7579904-7579926 GGTGTTGTTGAGGATCTTGAGGG + Exonic
1067167656 10:43878348-43878370 GGTGGGCATGTGCAACTTGAAGG - Intergenic
1067941956 10:50664421-50664443 GGTGGTTTTGTGTATTTTGACGG - Intergenic
1068278519 10:54835550-54835572 GGTGGGGATGTGTATGTTGGTGG - Intronic
1069903129 10:71717242-71717264 GGTGGGGTGGGGCAGCTTGGTGG + Intronic
1070863198 10:79689372-79689394 GGTGGTTTTGTGTATTTTGACGG - Intergenic
1072202704 10:93175610-93175632 GGTGGGGTTGTGAGGCTGGAAGG + Intergenic
1074525642 10:114260881-114260903 GCTGAGCTTGTGCATCTTTAGGG - Intronic
1077324365 11:1957334-1957356 GGTGGGCTTGAGCATCCTGTTGG + Intronic
1077406449 11:2384464-2384486 TGTGGGGTGGGGCATCTTGTGGG + Intronic
1077406461 11:2384498-2384520 TGTGGGGTGGGGCATCTTGTGGG + Intronic
1077803605 11:5567529-5567551 GGAGTGGTTCTGCATCTGGATGG - Intronic
1078180749 11:9008041-9008063 GATGGGGTGGTGCATGATGAGGG - Intergenic
1078929250 11:15900920-15900942 AGTGGGGTTGTGCATAGTTAAGG - Intergenic
1081855388 11:46300137-46300159 GGTGGTGTCCTCCATCTTGATGG - Exonic
1082863016 11:57873402-57873424 GGTGTGGGTGTGGATTTTGAAGG + Intergenic
1084365353 11:68693946-68693968 GTTGAGGTTGTGCACCTTGGAGG + Intergenic
1085022544 11:73218432-73218454 GGTGGGGTGGGGCGTCTGGAGGG + Exonic
1087169605 11:95037633-95037655 GGTCAGGTTGTCCACCTTGAGGG - Intergenic
1087172739 11:95067270-95067292 GGTCAGGTTGTCCACCTTGAGGG - Exonic
1088741373 11:112770104-112770126 GGTGGGGATGTGCTTCATGAGGG + Intergenic
1088946120 11:114514526-114514548 GGTGTGGTGGTGCATGCTGATGG - Intergenic
1089302180 11:117505332-117505354 GGTGGGCTCCAGCATCTTGAAGG - Intronic
1202807346 11_KI270721v1_random:12511-12533 GGTGGGCTTGAGCATCCTGTTGG + Intergenic
1092929572 12:13302765-13302787 GGTAAGGTTCTGTATCTTGATGG - Intergenic
1095494537 12:42770767-42770789 GGTCTGGATGTGCTTCTTGAAGG - Intergenic
1096393351 12:51246898-51246920 GGTGGGGTGGTGAAATTTGAAGG - Intronic
1096629986 12:52920295-52920317 GCTGGGGCTGTCCATTTTGATGG - Intronic
1098028377 12:66230023-66230045 GTTGGGGTTTTGGCTCTTGATGG + Intronic
1099886894 12:88542482-88542504 GGTGGGGCAGAGCATCTTGAAGG - Intronic
1101957279 12:109222694-109222716 GGTGGGACTGTGCATGGTGAGGG - Intronic
1102044039 12:109818533-109818555 GGGGTGGTTGTGAAGCTTGAAGG - Intronic
1105905092 13:24801499-24801521 GGTGTGGTAGTGCACCATGAAGG + Intronic
1106645514 13:31629774-31629796 GGTGGGGTAGAGCATCAAGAGGG - Intergenic
1107654502 13:42577664-42577686 GGTTGGTTTGTGCATATTGGGGG - Intronic
1109765082 13:66884515-66884537 GGTGGTGATGTTCATTTTGAAGG + Intronic
1110070622 13:71172405-71172427 GGTAGGGTTGTGCTCCTTTATGG + Intergenic
1114355858 14:21907391-21907413 GATGGAGTTCTGTATCTTGAAGG + Intergenic
1118571718 14:67200915-67200937 GGTGGGGTTGTGCATCTTGAAGG - Intronic
1120319893 14:82946131-82946153 GGTGGGGTTCTGCTTATTGGAGG - Intergenic
1120899717 14:89565272-89565294 GGCGGGGCTGTGCAGCCTGAAGG - Intronic
1121195080 14:92064585-92064607 GGAATGGTTGTGTATCTTGATGG - Intronic
1121581382 14:95034864-95034886 AGGAGGGATGTGCATCTTGATGG + Intergenic
1122748396 14:103914675-103914697 GGTGGTGTTGGGCATAGTGACGG + Intronic
1124426677 15:29569275-29569297 GGTGTGGTTGTTCATCCTAATGG - Intronic
1124584321 15:30991477-30991499 GGTGGGTTTGGGCGGCTTGAGGG + Exonic
1125756166 15:42066465-42066487 GGTGGGGGGGTGCTTATTGAAGG + Intergenic
1126732049 15:51693789-51693811 GCAGGGCTTGTACATCTTGAGGG + Intronic
1126849615 15:52789237-52789259 GTTGGGGGTGAGCATCTTGTCGG + Exonic
1127581754 15:60345201-60345223 TCTGGGGTTGTGCAACATGATGG + Intergenic
1128323007 15:66705734-66705756 GGTGGGATTATGTTTCTTGAGGG - Intronic
1128749933 15:70141530-70141552 GGTGGGGCTGTGGAACTTGGAGG + Intergenic
1130313929 15:82779151-82779173 GGTGTGGTTCTGGATCTTGTTGG - Intronic
1131057051 15:89381234-89381256 GGGAGGGTTATGCTTCTTGATGG + Intergenic
1131610048 15:93951141-93951163 GGTGGGGGTGTGCATGAGGAGGG - Intergenic
1132064929 15:98722928-98722950 GGTGGGATTCTTCCTCTTGAAGG + Intronic
1133732914 16:8591332-8591354 GGTGGTGTTGTCCATGGTGATGG - Intergenic
1134325933 16:13207648-13207670 GGTGGTCTTGTGAATCTGGAGGG + Intronic
1136083158 16:27866388-27866410 GGTGGGGTTGTGCAGATTAAAGG - Intronic
1142183092 16:88681179-88681201 AGTGCGGATGTGCATCTTGAGGG + Exonic
1144282103 17:13736511-13736533 GGTGGGGTTGAGCATCTACTTGG - Intergenic
1148253744 17:46109514-46109536 GGTGGGGGTGTGGTTTTTGAGGG - Intronic
1148475781 17:47927844-47927866 GGTGGGGGACTGCATCTTCAGGG - Exonic
1149151745 17:53573268-53573290 GGTCAGGTTGTGCATGTAGATGG + Intergenic
1149229650 17:54518674-54518696 GGAGGGCTTGTGCATCCTGAGGG + Intergenic
1149604764 17:57916820-57916842 GGTGGGATTTTGCTGCTTGAAGG - Intronic
1151858066 17:76737095-76737117 GGTCAGGTTGTCCACCTTGAGGG + Exonic
1157009180 18:43625897-43625919 TGTGGGGTTGTGCATGGTGCAGG + Intergenic
1157751517 18:50182895-50182917 GGTGGGGTTTTGCATGCTGTAGG - Intronic
1158565352 18:58550333-58550355 GATGGGGTTGTTCATGATGAAGG - Intronic
1158771213 18:60519913-60519935 GGTGAGGTTGGGCATACTGACGG - Intergenic
1160583791 18:79901779-79901801 GATGGGGTTGTGTGTCTTCAGGG - Intergenic
1161815261 19:6495836-6495858 GGTGGGGGTGGTCAGCTTGAGGG + Exonic
1163645859 19:18488637-18488659 GACCGGGCTGTGCATCTTGAGGG + Intronic
1164814561 19:31185346-31185368 GCTGGGGTTGGGGAGCTTGAAGG - Intergenic
1167790516 19:51675955-51675977 GGAGGGGTTGTGCATTTAGCTGG - Intergenic
1167821207 19:51929247-51929269 GGTGCAGTTTTGCCTCTTGATGG - Intronic
928680787 2:33700255-33700277 GGTGGGCTGGTGCATGTTGATGG - Intergenic
929077776 2:38092667-38092689 GGGTGGGTTGTGCATTTTAAGGG + Intronic
933844205 2:86312235-86312257 GGTGAGATTGTGCCACTTGAAGG - Intronic
934853751 2:97716722-97716744 GGTGGTGATGGGCATCATGAAGG + Intronic
936249036 2:110853100-110853122 GGCGGGGTGGTCCATCTTGGTGG + Intronic
936506417 2:113111504-113111526 CGTGGGGTTGTGAATCTAGGCGG - Intronic
936687280 2:114842469-114842491 GGAGTTGCTGTGCATCTTGATGG - Intronic
937082448 2:119150064-119150086 GGTAGAGCTGTGCTTCTTGATGG - Intergenic
939872438 2:147540536-147540558 GGAGGGGGTGGGAATCTTGAAGG - Intergenic
940323714 2:152403086-152403108 ACTGGGGTTGTGGATTTTGAGGG + Intronic
945112057 2:206369281-206369303 GGTGGGGATGGGCTTCTTAAAGG + Intergenic
946823677 2:223655266-223655288 GCTGGAGTTGAGCATGTTGATGG - Intergenic
946975415 2:225142864-225142886 GGTGGGGTTGTGTGTGTTGGGGG + Intergenic
947625650 2:231616551-231616573 TGAGGAGTTGTGCACCTTGAAGG - Intergenic
1174353601 20:49984244-49984266 GCTTCGGATGTGCATCTTGAGGG - Exonic
1174609940 20:51790722-51790744 GGTGCGATAATGCATCTTGAGGG + Exonic
1181748359 22:24971727-24971749 GGGGGGGTCGTGGATCATGAAGG + Intronic
1182410796 22:30183916-30183938 CATGGGGTTGTGCACATTGAAGG - Intergenic
1184464928 22:44663345-44663367 GGTGGGGCTGTGCTCCTTCAGGG + Intergenic
1185288591 22:50013226-50013248 GGTGGCCTTTTGCATCTTGAGGG - Intergenic
950183956 3:10933747-10933769 GGTGGGGATGAGGATTTTGAAGG - Intronic
950630787 3:14280311-14280333 GGTGGGGTTGTGCATTGGGGTGG + Intergenic
952081423 3:29762252-29762274 GGTGGGGTCCTACATGTTGAAGG - Intronic
952207552 3:31195362-31195384 GGAGGGGTTGCACATTTTGAGGG - Intergenic
952348154 3:32508031-32508053 GGTGCGCTTGTGAATGTTGATGG - Intergenic
952542854 3:34386164-34386186 GGTGGGGTTGTCACTCTTTAGGG + Intergenic
954320024 3:49826049-49826071 GCTGGGGTTGTGCGCTTTGACGG - Intergenic
956912442 3:73832610-73832632 CGTGGGTTTGTTCATCCTGATGG + Intergenic
962201376 3:133403567-133403589 GGTGGGGATGTCCATTTTGGTGG + Intronic
962521998 3:136205817-136205839 GATGTGGTTGTGAATGTTGATGG + Intergenic
962569382 3:136696598-136696620 GGGGAGGTTGTGCATATTGGGGG + Intronic
965998389 3:174915202-174915224 GGTGGGGAGGTGCATTTTGAGGG + Intronic
967964854 3:194953034-194953056 GGTGGGGCTCAGCATCTGGATGG - Intergenic
969170381 4:5357513-5357535 GATTGGGTTTTGCATTTTGAGGG + Intronic
970733165 4:19132979-19133001 GGTGGGGCTTTGGATCCTGAAGG + Intergenic
973966789 4:56171004-56171026 GGTGGGATTCTGCATCATGGTGG + Intronic
984443582 4:179804816-179804838 GGTGGGGTTGGGCAACTTTGTGG - Intergenic
986029922 5:3884098-3884120 GGTGTGGTTTTGCATTCTGATGG - Intergenic
989814070 5:45713786-45713808 GGTGGTTTTGTGCATCTTGTAGG - Intergenic
990815298 5:59778226-59778248 AGTGTGGTAGTGAATCTTGATGG - Intronic
991981707 5:72238674-72238696 TGTGGGATTGTGGATCTTGGAGG - Intronic
993021551 5:82597641-82597663 GGAGGGGTAGTCCATCTGGAAGG - Intergenic
994578367 5:101609627-101609649 GTTTGTGTTGTGCATCTTAAAGG - Intergenic
996776944 5:127142889-127142911 GGTGAGGTTGGGCATATTGACGG + Intergenic
997294906 5:132763153-132763175 GGAAGTGCTGTGCATCTTGAAGG - Intronic
997944223 5:138184743-138184765 GGTGGGCTTGTGCCTTCTGAGGG + Intronic
998407231 5:141880814-141880836 GGTGTGTGTGTGCATGTTGAGGG + Intergenic
1001108528 5:168876033-168876055 AATGGGGTGCTGCATCTTGAAGG - Intronic
1002399071 5:178981173-178981195 CCTGGGGCTGTGCATCTGGATGG - Exonic
1003343604 6:5244902-5244924 GGTGGGGTTGGGCAGGCTGAGGG + Intronic
1006416665 6:33908452-33908474 GGTGTGGTTGACCATCTGGATGG - Intergenic
1009624995 6:66127262-66127284 TGTGGGAGTGTGCATCATGAAGG + Intergenic
1012701071 6:102458466-102458488 GGTGGGCTTCTGCTTCTTCAGGG + Intergenic
1013494853 6:110688600-110688622 GGTGGGGATGTATATCTTGGAGG - Intronic
1016962174 6:149684298-149684320 GGTGGAGTTGTACCTCTTGGAGG + Exonic
1017187574 6:151617498-151617520 GGTGGGGTTGTGCCCATGGATGG - Intronic
1018172083 6:161151500-161151522 GGTGGGGTTGCCCAGCTTGCAGG - Intronic
1019051913 6:169190151-169190173 GGTGGGGTTGAGTATTATGAAGG - Intergenic
1019660469 7:2221140-2221162 GGTGGGGTGGGGCATAGTGAGGG - Intronic
1020806370 7:12795123-12795145 TGTGGGGTTGTACATATGGATGG - Intergenic
1022902480 7:34824850-34824872 GGTGGGGGTGTGAAGCCTGATGG - Intronic
1024195253 7:47052836-47052858 GGTCAGGTTGTCCACCTTGAGGG - Intergenic
1026987292 7:74562451-74562473 GGTGTGCTTGTCCATCTTGGCGG - Intronic
1027481966 7:78709266-78709288 GGTGGGGGTGTGTATGTTGCAGG - Intronic
1033396835 7:140982780-140982802 GGTTTGGTTCTGCATCTTCAAGG + Intergenic
1034869387 7:154670218-154670240 CGGGGGGTTTTGCATGTTGACGG - Intronic
1034879575 7:154752988-154753010 GCTGGGGTTGTGTTTCTTGGGGG + Intronic
1040532337 8:48276059-48276081 CGTGGGGTTGTGCCCCTTGAGGG + Intergenic
1041391481 8:57350852-57350874 AGTGGGGTTGTGTATCCTTAGGG - Intergenic
1041714881 8:60923828-60923850 GGAGGTGTTGTACATATTGAAGG - Intergenic
1042212071 8:66390971-66390993 GTTGGGCTTGTGAATCATGAAGG - Intergenic
1042955431 8:74244967-74244989 GCTGGGGTTTTGCTTCTTCAGGG + Exonic
1048165043 8:132054893-132054915 GGTGGGGGTGGGCCTGTTGAAGG + Intronic
1050154256 9:2649251-2649273 GGAGGGTTGGTGCCTCTTGAGGG + Intronic
1057470432 9:95351408-95351430 GGTTGAGTTGTGGATCTTGGGGG - Intergenic
1058161117 9:101571581-101571603 GGTGGGGGTGAGGATGTTGAAGG + Exonic
1060042095 9:120308631-120308653 GGCAGGGCTGTGCCTCTTGAGGG + Intergenic
1062319358 9:135982874-135982896 AGTGGGGTTCTGCTTCTTGCTGG - Intergenic
1062451768 9:136618760-136618782 GGTGGGGTTCTGCCACTTGCTGG - Intergenic
1188789203 X:34387765-34387787 GGTCAGGTTGTCCACCTTGAGGG - Intergenic
1193300637 X:79885126-79885148 GGTGGGGATGTGTATTCTGAAGG - Intergenic
1193776784 X:85652082-85652104 GGTGGGGTTGGGTACTTTGAAGG - Intergenic