ID: 1118581754

View in Genome Browser
Species Human (GRCh38)
Location 14:67307491-67307513
Sequence ATGATTATGTACTCTGTGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 665
Summary {0: 1, 1: 0, 2: 3, 3: 64, 4: 597}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118581753_1118581754 26 Left 1118581753 14:67307442-67307464 CCAGAAAATTAACAGATTATTGA 0: 1
1: 0
2: 1
3: 37
4: 337
Right 1118581754 14:67307491-67307513 ATGATTATGTACTCTGTGCCAGG 0: 1
1: 0
2: 3
3: 64
4: 597

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118581754 Original CRISPR ATGATTATGTACTCTGTGCC AGG Intronic
900848854 1:5126098-5126120 ATGATTATGGACCTTGAGCCAGG - Intergenic
901300788 1:8198765-8198787 TTGAGTATCTACTGTGTGCCAGG - Intergenic
901928227 1:12580449-12580471 ATGAGAATGTTCTCTTTGCCCGG + Intronic
902210452 1:14900974-14900996 ATGAGCATTTACTCTGTGCCAGG + Intronic
902232209 1:15035271-15035293 ATGATGCTATACTATGTGCCAGG - Intronic
902397329 1:16139441-16139463 ATGATCCTCTGCTCTGTGCCTGG + Intronic
902929699 1:19722399-19722421 CTCAGTATGTACTATGTGCCAGG + Intronic
902937705 1:19776446-19776468 ATGAATCTGGACTGTGTGCCAGG - Intronic
903141078 1:21339573-21339595 ATGAGCATCTACTATGTGCCTGG - Intronic
903503656 1:23817046-23817068 TTGAGAATGTACTCTGGGCCAGG + Intronic
904088132 1:27925315-27925337 ATGAATATATATTCAGTGCCAGG + Intergenic
904313672 1:29646081-29646103 ATGAGCATCTACTATGTGCCAGG - Intergenic
904334146 1:29786133-29786155 ATGAGTGTTTACTATGTGCCAGG - Intergenic
905145777 1:35885800-35885822 ATAAACATGTATTCTGTGCCAGG - Intronic
905147041 1:35894800-35894822 ATGAGTGTCTACTCTGTGTCAGG + Intronic
905618382 1:39417890-39417912 ATGAGTACCTACTCTGTGCCAGG + Intronic
906581893 1:46941677-46941699 ATGAGCATTTACTGTGTGCCAGG + Intergenic
906601822 1:47137220-47137242 ATGAGCATTTACTGTGTGCCAGG - Intergenic
906816818 1:48887892-48887914 CTGATCATCTACCCTGTGCCAGG - Intronic
907109571 1:51914533-51914555 ATGAATATATATTATGTGCCAGG - Exonic
907330650 1:53669170-53669192 CTGAACATGTCCTCTGTGCCTGG + Intronic
907457610 1:54585518-54585540 CTGAGTGTGTACTATGTGCCAGG + Intronic
907540480 1:55212418-55212440 ATGATTATGTAGTGGGTGGCAGG - Intronic
907593246 1:55695872-55695894 TTAACCATGTACTCTGTGCCAGG - Intergenic
907760787 1:57357064-57357086 TTGAACATGTACTGTGTGCCAGG - Intronic
907943917 1:59115352-59115374 CTGAGTGTCTACTCTGTGCCAGG - Intergenic
908090469 1:60680180-60680202 ATGGTTTTTTACTATGTGCCAGG + Intergenic
908137142 1:61144756-61144778 CTGAGCATGTACCCTGTGCCAGG - Intronic
908855594 1:68423399-68423421 CTGATTATCTACTGTGTGCCAGG - Intergenic
909502335 1:76348909-76348931 CTGAGTATGTACTATGAGCCAGG - Intronic
909514218 1:76489338-76489360 TTGAGTATGTACTATGTGACAGG + Intronic
910917756 1:92309146-92309168 ATGAAAATGTCCTTTGTGCCGGG + Intronic
911002139 1:93177709-93177731 TTGATTATTTACTATGTGTCAGG + Intronic
911089761 1:94009217-94009239 CTGAGTCTTTACTCTGTGCCAGG - Intronic
911344831 1:96683601-96683623 TTGAGTGTTTACTCTGTGCCAGG - Intergenic
911604289 1:99885374-99885396 ATGAGCATTTACTATGTGCCAGG - Intronic
911692630 1:100851655-100851677 TTGATTATCCACTATGTGCCAGG + Intergenic
912164918 1:107031508-107031530 ATGCATATGTATTATGTGCCAGG - Intergenic
912188474 1:107309516-107309538 TTGACTATCTACTCTCTGCCAGG + Intronic
912664290 1:111565110-111565132 TGCATTATGTTCTCTGTGCCTGG - Intronic
912692145 1:111812476-111812498 ATGATTGTCTACTTTGTGCAAGG - Intronic
912764234 1:112394475-112394497 TTGAGTACCTACTCTGTGCCTGG + Intergenic
913078102 1:115358542-115358564 ATGAGTATCTACTCTGGACCAGG + Intergenic
914333945 1:146698234-146698256 TTGAGGATGTACTCTGTGCTGGG - Intergenic
914700743 1:150130823-150130845 TTGAATATATACTATGTGCCAGG + Intronic
914873607 1:151496045-151496067 TTGATTATCTACTGTGTGTCAGG - Intergenic
915882367 1:159685459-159685481 ACTATTATGTTCTCAGTGCCTGG + Intergenic
916082454 1:161243388-161243410 ATGGGTATCTACTTTGTGCCAGG + Intergenic
916312416 1:163411731-163411753 TTGATTGTGTACTATGTGTCAGG + Intergenic
916592710 1:166207892-166207914 AAGAAAATGTACTCTGTGGCTGG - Intergenic
916704937 1:167339600-167339622 ATGGTTATCTGCCCTGTGCCTGG + Intronic
917253005 1:173082700-173082722 TTCATTATGAACTCTTTGCCAGG - Intergenic
917455554 1:175182830-175182852 CTGAAGATGTGCTCTGTGCCAGG - Intronic
917540639 1:175910459-175910481 AGGAATATGTCCTCAGTGCCTGG - Intergenic
917595740 1:176527532-176527554 GTGAGCATATACTCTGTGCCAGG - Intronic
919127467 1:193413194-193413216 GTGAGTATCTACTGTGTGCCAGG + Intergenic
920538758 1:206761185-206761207 TTAAGTATTTACTCTGTGCCGGG + Intergenic
920698807 1:208202329-208202351 TTGAATATGTACTGTGTGCCAGG - Intronic
920826340 1:209427149-209427171 ATGAGCATCGACTCTGTGCCAGG - Intergenic
921009041 1:211123060-211123082 TTGAGTATCTACTCTGTCCCAGG + Intronic
921499765 1:215887363-215887385 ATGATTATTAACTCTATGCTTGG + Intronic
921783267 1:219194655-219194677 CTGAGTATTTGCTCTGTGCCAGG - Intronic
921849994 1:219924737-219924759 TTGAGTATGTACTTTGTCCCTGG - Intronic
921907125 1:220506879-220506901 TTGAGCATGTACTCTGTACCAGG - Intergenic
922581050 1:226698205-226698227 CTGAATATCCACTCTGTGCCAGG - Intronic
922983238 1:229846562-229846584 ATTATTATGTTCCCTCTGCCTGG - Intergenic
1063606955 10:7531123-7531145 CTTAGTATCTACTCTGTGCCGGG + Intergenic
1063927189 10:10991982-10992004 TTGAGTATCTACTGTGTGCCAGG + Intergenic
1064544809 10:16439458-16439480 ATGACCGTGTACTCAGTGCCAGG + Intronic
1065143586 10:22743951-22743973 ATTACTACTTACTCTGTGCCAGG + Intergenic
1066758289 10:38731353-38731375 ATGATCATCTACCGTGTGCCAGG - Intergenic
1069083065 10:64108709-64108731 CTGAGTATCTACTCTGTGCTTGG + Intergenic
1069851311 10:71406933-71406955 TTTATTAAGTACTGTGTGCCAGG + Intronic
1070005976 10:72424429-72424451 CTGAGTATGTACTATGGGCCAGG + Intronic
1070421091 10:76238084-76238106 ATGAATATGCACTCTTAGCCAGG - Intronic
1071250108 10:83809204-83809226 TTGAATAGGTACTCTGTGCCAGG - Intergenic
1072048086 10:91677105-91677127 TTTATTATTTACTCTGTGCCAGG + Intergenic
1073272114 10:102274059-102274081 TTGATTACTTACTATGTGCCAGG + Intronic
1073944617 10:108735968-108735990 TTCATTATGAAATCTGTGCCAGG + Intergenic
1073973472 10:109072600-109072622 AATATTTTGTAATCTGTGCCGGG - Intergenic
1074297270 10:112201909-112201931 TTGAGCATTTACTCTGTGCCAGG + Intronic
1075209317 10:120477760-120477782 CTGAGTATCTACTATGTGCCAGG - Intronic
1075279126 10:121123678-121123700 TTGATCATCTACTATGTGCCAGG + Intergenic
1075582997 10:123636315-123636337 ATTTTTATGTCCTCAGTGCCTGG - Intergenic
1075822533 10:125327136-125327158 CTGAGTATCTACTCTGTGCCAGG - Intergenic
1075991475 10:126842299-126842321 CTGAATACCTACTCTGTGCCAGG + Intergenic
1076057528 10:127387698-127387720 ATGAGCATGTGCTGTGTGCCAGG - Intronic
1078001001 11:7495651-7495673 TTGATTCTCTACTCTGTTCCAGG - Intronic
1078134135 11:8638365-8638387 TTGAACATGTACTCTGTGCTTGG - Intronic
1078201021 11:9183337-9183359 TTTATTATGTACTATGTGCCTGG - Intronic
1078281426 11:9905475-9905497 TTGAGTATCTACTATGTGCCAGG + Intronic
1078903743 11:15665532-15665554 TTGAGCATGTACTATGTGCCAGG + Intergenic
1079125121 11:17713549-17713571 ATTATTTTGTTCTCTCTGCCGGG + Intergenic
1079317695 11:19423091-19423113 ATGAGTATTTACTGTGTGTCAGG - Intronic
1079338506 11:19592282-19592304 ATGATCAGGTTCTCTCTGCCTGG + Intronic
1079470051 11:20769550-20769572 TGGAGTATGTTCTCTGTGCCAGG - Intronic
1079824687 11:25175754-25175776 ATGGTCATGAACTCTGTGCTAGG - Intergenic
1080081982 11:28231924-28231946 TTGAGTATGTACTATATGCCAGG - Intronic
1080224728 11:29948039-29948061 TTGAATATGTACTATATGCCAGG + Intergenic
1080538685 11:33245906-33245928 ATCATTACGTCCTCAGTGCCTGG + Intergenic
1080609734 11:33893421-33893443 ATGAGTACCTACTGTGTGCCAGG - Intergenic
1081027394 11:38032742-38032764 ATGATTAACTACTATGTGCCAGG + Intergenic
1081440805 11:43078723-43078745 TTTATTCTCTACTCTGTGCCAGG + Intergenic
1081539996 11:44027520-44027542 ATGAGCACTTACTCTGTGCCAGG - Intergenic
1081998163 11:47377796-47377818 ACAATCATGTCCTCTGTGCCAGG + Intronic
1082041309 11:47687489-47687511 TTGAATATTTACTGTGTGCCAGG - Intronic
1082854460 11:57794170-57794192 ACGAGTATGTACAATGTGCCAGG - Intronic
1082899621 11:58232783-58232805 TTGAATGTGTACTCTGTGCTGGG - Intergenic
1083145412 11:60754693-60754715 ATGAGTGTTTACTATGTGCCAGG + Intergenic
1083370704 11:62177350-62177372 ATGATTGTATACTCTGTGGTAGG + Intergenic
1083946758 11:65927932-65927954 CTGAGTACCTACTCTGTGCCGGG + Intergenic
1084072944 11:66748644-66748666 ATGATTATGTAATAAGTGTCTGG + Intronic
1085614503 11:77985687-77985709 CTGAATACTTACTCTGTGCCAGG - Intronic
1086434456 11:86767599-86767621 CTGATTATCTACTATGTGCCAGG - Intergenic
1086768895 11:90735787-90735809 ATGAAAATGTAATCTCTGCCTGG - Intergenic
1089024814 11:115258586-115258608 ATGGTTTTGGACTCTGGGCCTGG - Intronic
1089177624 11:116559939-116559961 ATGGGTATTTACTTTGTGCCAGG - Intergenic
1089338824 11:117744059-117744081 ATGATTTATTACTCAGTGCCAGG - Intronic
1089399936 11:118158570-118158592 CTGAGTACCTACTCTGTGCCTGG - Intergenic
1089414739 11:118278287-118278309 ATGATTTTATAATCAGTGCCTGG - Intergenic
1089795974 11:120981281-120981303 TTGACTATATACTGTGTGCCAGG + Intronic
1089881715 11:121780388-121780410 TTGAGTATCTACTATGTGCCAGG - Intergenic
1090304681 11:125681011-125681033 ATGATTATTTTCTGTGTGCAGGG + Exonic
1091003880 11:131934445-131934467 ATGAATATTTACCCTGTGTCAGG - Intronic
1091864822 12:3823490-3823512 CTGAGTGTGTACTATGTGCCAGG - Intronic
1092354798 12:7785841-7785863 ATGATTTTCTACTTTTTGCCTGG + Intergenic
1093609864 12:21141094-21141116 TTGAATATCTACTCTGTGCAAGG + Intronic
1093953311 12:25189193-25189215 ATGAATTTCTACTATGTGCCAGG + Intronic
1094161292 12:27393717-27393739 TTGAGTGTGTACTATGTGCCAGG + Intronic
1095226371 12:39681771-39681793 ATGATCACCTACTCTGTTCCAGG - Intronic
1095702479 12:45204613-45204635 TTGAGTATCTACTATGTGCCAGG + Intergenic
1095914123 12:47458776-47458798 TTGAGTATGTACTATGTGCCAGG - Intergenic
1096321294 12:50615672-50615694 TTGAGTATGTGCTGTGTGCCAGG + Intronic
1096394198 12:51253278-51253300 CTGAGTGTGTACTCTGTGCCAGG + Intronic
1096421393 12:51461336-51461358 TTGAATATTTACTCTGTGCCAGG + Intronic
1097094534 12:56535878-56535900 ATGATCATTTACTATGTGCCAGG - Intronic
1097326706 12:58285375-58285397 ATAATTATGTACTCTTTTACTGG + Intergenic
1098087069 12:66857410-66857432 ATGATTAACTACTGTGAGCCAGG + Intergenic
1099875457 12:88399650-88399672 ATTATTATGAACTATGTGACAGG - Intergenic
1100044560 12:90363560-90363582 ATGAATATGTGCTTTGTGGCTGG - Intergenic
1100727706 12:97426580-97426602 TTGAATATTTACTGTGTGCCAGG + Intergenic
1101283665 12:103286541-103286563 CTGATTATTTACTATGTGCTAGG - Intronic
1101405366 12:104423913-104423935 TTGAAAATTTACTCTGTGCCAGG + Intergenic
1101772628 12:107765597-107765619 TTGAGTGTCTACTCTGTGCCAGG + Intergenic
1102001187 12:109558941-109558963 ATGAACATCTGCTCTGTGCCAGG - Intronic
1102184029 12:110933899-110933921 ATGATCACCTACTATGTGCCAGG - Intergenic
1102625292 12:114230517-114230539 ATGAGTATTTACTATGTGCCTGG + Intergenic
1102701127 12:114840315-114840337 GTGCTTATGTACTCTATACCAGG + Intergenic
1102869605 12:116403266-116403288 ATGAGCACCTACTCTGTGCCAGG + Intergenic
1103066273 12:117900519-117900541 TTGAAAATGTACTGTGTGCCAGG + Intronic
1103356080 12:120321604-120321626 CTGATTATTTACTCTGTACCAGG - Intergenic
1103376728 12:120462262-120462284 CTTACTGTGTACTCTGTGCCTGG + Exonic
1104238955 12:126968343-126968365 ATTATAATGTAGTCTGTGCAGGG - Intergenic
1106013423 13:25846200-25846222 AAGAATATGTTCTCTATGCCAGG + Intronic
1106240428 13:27907880-27907902 CTAAATATCTACTCTGTGCCAGG - Intergenic
1106251026 13:27981551-27981573 ATGAGTGTCTGCTCTGTGCCAGG - Intronic
1106805245 13:33299759-33299781 ATGAATGCCTACTCTGTGCCAGG + Intronic
1107292364 13:38869444-38869466 ATGAACACCTACTCTGTGCCAGG + Intronic
1107407750 13:40130415-40130437 ATGAGCACATACTCTGTGCCAGG + Intergenic
1108401666 13:50051295-50051317 TTGAATATCTACTATGTGCCAGG + Intergenic
1108621687 13:52191179-52191201 GTGAATATCTACTCTGTGCTGGG + Intergenic
1108665052 13:52621004-52621026 GTGAATATCTACTCTGTGCTGGG - Intergenic
1108719927 13:53120690-53120712 CTTATTATTTACTATGTGCCAGG + Intergenic
1108730783 13:53233390-53233412 ATGAGTATTCACTCTGTGCCAGG - Intergenic
1108780707 13:53827879-53827901 TTGAATGTTTACTCTGTGCCAGG - Intergenic
1110105753 13:71674103-71674125 TTGAATATCTGCTCTGTGCCAGG + Intronic
1110702648 13:78566872-78566894 ATGAGAGTGTACTATGTGCCAGG - Intergenic
1111106970 13:83658472-83658494 TTGAGCATTTACTCTGTGCCTGG - Intergenic
1111269143 13:85857095-85857117 TTGAGTATCTACTCTGTGTCAGG - Intergenic
1111983093 13:95037816-95037838 AAAATTATTTACTGTGTGCCTGG + Intronic
1112400194 13:99070571-99070593 GTGAGTATTTACTGTGTGCCAGG + Intronic
1113081485 13:106525034-106525056 TTGAATATGTACTGTGTGCCTGG - Intronic
1115767785 14:36641784-36641806 ATTATTATATCCTCTGTGCAAGG - Intergenic
1116947396 14:50848420-50848442 ATGATTAGGAACTCTGTGTCAGG + Intergenic
1117477007 14:56105741-56105763 GTGAGTGTCTACTCTGTGCCAGG - Intergenic
1117491131 14:56249217-56249239 TTGAGCATTTACTCTGTGCCAGG + Intronic
1117837894 14:59826738-59826760 TTGAGTACCTACTCTGTGCCAGG + Intronic
1118581754 14:67307491-67307513 ATGATTATGTACTCTGTGCCAGG + Intronic
1118645527 14:67834925-67834947 ACAAATATTTACTCTGTGCCAGG - Intronic
1118810339 14:69268584-69268606 CTGAGCATGTACTATGTGCCAGG + Intronic
1120761537 14:88289850-88289872 CTGAGTATTTACTATGTGCCAGG - Intronic
1121199196 14:92103652-92103674 TTGAGTACTTACTCTGTGCCAGG + Intronic
1121540094 14:94719116-94719138 CTGATCATCTACTTTGTGCCAGG - Intergenic
1121742111 14:96261343-96261365 CTGAGAATGTACTATGTGCCAGG - Intronic
1122021200 14:98839337-98839359 GTGAATATCTACTTTGTGCCAGG - Intergenic
1123206793 14:106721115-106721137 TTGGTTATGCACTCTGTCCCAGG + Intergenic
1123211815 14:106768120-106768142 TTGGTTATGCACTCTGTCCCAGG + Intergenic
1123967371 15:25472510-25472532 TTGAGCATGTTCTCTGTGCCAGG + Intergenic
1124091435 15:26606364-26606386 ATTATTATGTACTGCATGCCGGG + Intronic
1125227893 15:37415955-37415977 ATGTTTATTTCCTTTGTGCCAGG - Intergenic
1125985388 15:44046097-44046119 CTGAGTATGTACTCTGTCCAGGG - Intronic
1126258541 15:46657921-46657943 TTGAGTATTTACTGTGTGCCAGG + Intergenic
1129064346 15:72888721-72888743 ATCATTACCTGCTCTGTGCCAGG - Intergenic
1129243462 15:74265635-74265657 GTGAGTATCTACTATGTGCCAGG - Intronic
1129367918 15:75068379-75068401 ATGTATATGTGCTCTGTGCTAGG + Intronic
1130135061 15:81175503-81175525 CTGAGTGTTTACTCTGTGCCAGG - Intronic
1130310801 15:82752376-82752398 CTGTTTGTGTTCTCTGTGCCTGG - Intergenic
1130363490 15:83211469-83211491 ATGAGAATTTACTATGTGCCAGG - Intergenic
1131203331 15:90419958-90419980 TTGAGTACTTACTCTGTGCCAGG + Intronic
1131984477 15:98028075-98028097 CTGAGTACATACTCTGTGCCAGG + Intergenic
1132148447 15:99442791-99442813 ATGATTTTGTACCAGGTGCCTGG - Intergenic
1132988797 16:2782627-2782649 CTGAGTATGTGCACTGTGCCAGG - Intergenic
1133045127 16:3083688-3083710 AAGAGTTTGTACGCTGTGCCTGG - Intergenic
1133826065 16:9279298-9279320 CTGAGTATCTACTATGTGCCGGG - Intergenic
1134636733 16:15798361-15798383 TTGAACATGTACTCTGTGCCAGG - Intronic
1134783102 16:16916749-16916771 ATGAACACTTACTCTGTGCCAGG - Intergenic
1135269558 16:21057299-21057321 TTGATCATCTACTCTGTGCTGGG + Intronic
1135514973 16:23124286-23124308 ATTATTTTGTACTCTTTGCCAGG - Intronic
1135663406 16:24315983-24316005 TTGAGCATGTACTATGTGCCAGG + Intronic
1135732620 16:24907342-24907364 ATGGTTATGTGCCCTGTGCCTGG - Intronic
1136732970 16:32435319-32435341 CTGAATACCTACTCTGTGCCAGG + Intergenic
1137564741 16:49525884-49525906 TTGAGCATGTACTATGTGCCAGG + Intronic
1137703454 16:50517264-50517286 ATTATTTTGAACTCTTTGCCAGG + Intergenic
1137989714 16:53141636-53141658 ATGAGTATTTACTGTGTGGCAGG + Intronic
1138972483 16:62162323-62162345 ATGAATATGTCCTTTGTGTCAGG + Intergenic
1139717689 16:68826660-68826682 TTGATTGCTTACTCTGTGCCAGG + Intronic
1139999673 16:71013015-71013037 TTGAGGATGTACTCTGTGCTGGG + Intronic
1140668011 16:77245399-77245421 ATGATGATCTACTATGAGCCAGG + Intergenic
1140795627 16:78434868-78434890 TTGCTTAGGGACTCTGTGCCAGG + Intronic
1140965376 16:79961248-79961270 ATGAGTGTTTGCTCTGTGCCCGG - Intergenic
1141250199 16:82349027-82349049 TTGAGTATTTATTCTGTGCCAGG + Intergenic
1141271827 16:82547820-82547842 ATTATTACCTCCTCTGTGCCAGG + Intergenic
1141346687 16:83253047-83253069 TTGAGTACTTACTCTGTGCCAGG - Intronic
1203020111 16_KI270728v1_random:394284-394306 CTGAATACCTACTCTGTGCCAGG - Intergenic
1203038446 16_KI270728v1_random:667442-667464 CTGAATACCTACTCTGTGCCAGG - Intergenic
1142526989 17:550067-550089 ATGAGCATTTACTATGTGCCTGG + Intronic
1143047779 17:4096234-4096256 ATGATGATTTACTCTGTGTCAGG - Intronic
1143423912 17:6817841-6817863 CTGAGCATGTACTATGTGCCAGG - Intronic
1144089063 17:11837291-11837313 ATGAGTACCTACTATGTGCCAGG + Intronic
1146152146 17:30483360-30483382 ATGAGCATCTACTATGTGCCAGG + Intronic
1148428439 17:47621305-47621327 ATCCTTAAGTACTCTGTGCTAGG + Intronic
1148961788 17:51399419-51399441 TTAAGTATGTACTGTGTGCCAGG + Intergenic
1149245005 17:54695523-54695545 TTGAATATCTACTTTGTGCCAGG + Intergenic
1149868730 17:60164708-60164730 ACTATTATTTCCTCTGTGCCAGG + Intronic
1150177286 17:63072047-63072069 ATTACTATGTACTCTCTGCCAGG - Intronic
1151177300 17:72299399-72299421 TTAAATATGTACTCTGTGCCAGG - Intergenic
1151424607 17:74022789-74022811 TTGAGTATGTACTACGTGCCAGG - Intergenic
1151773457 17:76180502-76180524 CTGAGTATCTACTATGTGCCAGG + Intronic
1152514122 17:80812230-80812252 ATGATTGTCAAGTCTGTGCCTGG + Intronic
1153445712 18:5170522-5170544 ATGAGGATGTACAATGTGCCAGG - Intronic
1155421021 18:25655904-25655926 TTGATTATTTACCATGTGCCAGG - Intergenic
1155612979 18:27689412-27689434 CTGCTTATGTCCTTTGTGCCAGG + Intergenic
1156350957 18:36300426-36300448 CTGACTATGCACTCTGTGTCAGG - Intronic
1156525385 18:37762802-37762824 AAGACTATTTACTCTGTGCCTGG - Intergenic
1157104919 18:44764939-44764961 TTGAACATGCACTCTGTGCCAGG - Intronic
1157599140 18:48882971-48882993 TTGAGCATGTACTCTGTGCCAGG + Intergenic
1157730827 18:50002722-50002744 TTGAGTTTGTACTTTGTGCCAGG - Intronic
1158196083 18:54886369-54886391 TTGAGCATCTACTCTGTGCCAGG - Intronic
1158466153 18:57691617-57691639 TTGAGTATCCACTCTGTGCCAGG - Intronic
1158713850 18:59860892-59860914 AGGATTAAGTAGTCTGTGCAAGG + Intergenic
1159705631 18:71683106-71683128 TTTTTTATGTACTTTGTGCCAGG - Intergenic
1160348038 18:78151139-78151161 TTGAGTATCTACCCTGTGCCAGG + Intergenic
1161090705 19:2358628-2358650 CTGAGTATGTGCTGTGTGCCCGG - Intergenic
1161859355 19:6786184-6786206 TTGATTCCGTACTATGTGCCAGG - Intronic
1164690537 19:30207704-30207726 CTGAGCATGTACTATGTGCCAGG - Intergenic
1164742364 19:30585328-30585350 TTGAGAATCTACTCTGTGCCAGG - Intronic
1165805220 19:38576493-38576515 TTGAGTATTCACTCTGTGCCAGG - Intronic
1166327525 19:42060265-42060287 TTGAGCATGTGCTCTGTGCCAGG + Intronic
1166372552 19:42310249-42310271 ATGCTTCTTTCCTCTGTGCCAGG + Exonic
1167272375 19:48513233-48513255 ATGAGTATTTAGTCTGTGCCAGG + Intergenic
1167587826 19:50384704-50384726 GTGTTTGAGTACTCTGTGCCAGG + Intronic
1168158078 19:54489200-54489222 TTTATTATGTACTATGTGCTAGG + Intergenic
1168431445 19:56284363-56284385 CTGAGTATCTAGTCTGTGCCTGG + Intronic
1168566782 19:57431523-57431545 ATGATTATGTACCTTAGGCCTGG + Intronic
925039665 2:721744-721766 ATGTTCATTTACTCTGTGGCAGG + Intergenic
925321642 2:2974607-2974629 TTGATTACCTACTCTGTGCCAGG - Intergenic
925489945 2:4380219-4380241 CTGAATTTCTACTCTGTGCCTGG + Intergenic
926333311 2:11843888-11843910 TTGGATATGTACTCTGTGTCAGG - Intergenic
926452727 2:13025104-13025126 GTTATTATGCACCCTGTGCCAGG - Intergenic
926624512 2:15079856-15079878 TTAGTTATGTACTCTGTGCCTGG - Intergenic
926680945 2:15663628-15663650 ATGAGGATGTACTGTGTCCCAGG - Intergenic
926727137 2:16007465-16007487 ATGAGTACCTCCTCTGTGCCAGG + Intergenic
926823909 2:16883170-16883192 TTTATTATGTGCCCTGTGCCAGG + Intergenic
928061712 2:28120205-28120227 TTGAATATCTACTGTGTGCCTGG + Intronic
928142334 2:28740531-28740553 ATGAGCACCTACTCTGTGCCAGG - Intergenic
928504121 2:31930947-31930969 ATGATTTTTTAGTCTGGGCCTGG - Intronic
928587023 2:32770200-32770222 CTGAGTATTTACTCAGTGCCAGG + Intronic
928591679 2:32823399-32823421 AAGATTATTTACTCTTGGCCGGG + Intergenic
928615358 2:33033106-33033128 TTGAATATTTACTGTGTGCCAGG + Intronic
928895124 2:36252929-36252951 CTAAGTATCTACTCTGTGCCTGG + Intergenic
928926340 2:36583612-36583634 ATGAATATATACTCATTGCCTGG - Intronic
929485154 2:42346481-42346503 ATCAATAAGTACTCTGGGCCAGG + Intronic
930564892 2:53006410-53006432 TAGATTATCTACTATGTGCCAGG + Intergenic
931887614 2:66634017-66634039 TTTATTATGTGCTGTGTGCCAGG + Intergenic
932455742 2:71848869-71848891 CTGAGCATGTACTATGTGCCAGG + Intergenic
932694075 2:73939474-73939496 ATGAGCATGTACTATGTGCCAGG + Intronic
932840081 2:75073704-75073726 AGGATTTTCTTCTCTGTGCCTGG - Intronic
932851484 2:75191845-75191867 ATGAGTACCTACTCTGTGCCAGG + Intronic
933036997 2:77412151-77412173 ATGAATATCTCCTCAGTGCCAGG + Intronic
933272629 2:80249487-80249509 TTGAGCATGTACTTTGTGCCTGG + Intronic
934312742 2:91883956-91883978 CTGAATACCTACTCTGTGCCAGG - Intergenic
935236040 2:101138990-101139012 AGGATTAGGAGCTCTGTGCCAGG + Intronic
935350005 2:102144567-102144589 TTGACTATCTACTATGTGCCAGG + Intronic
935648379 2:105360796-105360818 ATGATTTCACACTCTGTGCCTGG + Intronic
935844237 2:107147331-107147353 CTGAATGTGTACTGTGTGCCAGG + Intergenic
936896349 2:117432305-117432327 TTGAATATTTACTATGTGCCAGG + Intergenic
937037631 2:118794952-118794974 CTGAACATTTACTCTGTGCCTGG + Intergenic
937081555 2:119143791-119143813 TTGATCATTTACTCAGTGCCGGG - Intergenic
937327654 2:121001087-121001109 GTGTTTATTTACTCTGTGGCAGG + Intergenic
938134682 2:128746196-128746218 TTGATTACTTACTTTGTGCCAGG - Intergenic
938781127 2:134585770-134585792 TTGAGCATGGACTCTGTGCCAGG - Intronic
938811863 2:134861412-134861434 TTGAGTATTTACTTTGTGCCAGG + Intronic
938953792 2:136280609-136280631 TTGAGCATCTACTCTGTGCCAGG + Intergenic
939412568 2:141848917-141848939 ATGAACATTTACTATGTGCCAGG - Intronic
939988353 2:148854395-148854417 TGGATTATGTACTGTATGCCAGG - Intergenic
940797261 2:158093214-158093236 ATGATTAAGTTCTCTGTGCTGGG - Intronic
940988929 2:160078051-160078073 AAGATTATGTAATCTGACCCAGG - Intergenic
941039033 2:160599648-160599670 ATGACTATTTACCATGTGCCAGG - Intergenic
941107336 2:161370801-161370823 TTAAAAATGTACTCTGTGCCTGG + Intronic
941220829 2:162778568-162778590 ATGCTTATCTACCGTGTGCCAGG - Intronic
941399672 2:165015154-165015176 ATGATTCTGGGCTCTGTGGCTGG - Intergenic
941463989 2:165803364-165803386 CTGAGTATTAACTCTGTGCCAGG + Intergenic
941709529 2:168697427-168697449 CTGATTATTTTCTGTGTGCCAGG + Intronic
942409272 2:175690971-175690993 ATGAACATTTACTGTGTGCCTGG - Intergenic
942731851 2:179069120-179069142 TTAAATATGTACTCAGTGCCAGG + Intergenic
942783550 2:179674171-179674193 ATGAACATCTACTCTATGCCTGG + Intronic
942895298 2:181046088-181046110 CTGATTATCTACCATGTGCCAGG - Intronic
942906119 2:181182768-181182790 ATGATTATGTATTAGGTGGCTGG - Intergenic
943176828 2:184486697-184486719 ATTAGGATGTACTGTGTGCCAGG - Intergenic
943809402 2:192165418-192165440 ATGAGTACGTACTATGTGTCAGG - Intronic
944321855 2:198354966-198354988 TTGAGTATTTACTATGTGCCTGG + Intronic
944679805 2:202066616-202066638 TTGAGCATGTACTATGTGCCTGG + Intergenic
944702903 2:202261483-202261505 TTGAGTGTCTACTCTGTGCCAGG - Intergenic
945062839 2:205923983-205924005 CTGAGCATGTACTGTGTGCCAGG + Intergenic
945872564 2:215244025-215244047 GTGTTTATTTACTCTGCGCCAGG + Intergenic
946282331 2:218674990-218675012 TTGAATATTTACTATGTGCCAGG + Intronic
946343757 2:219091035-219091057 ATAAGTATCTACTATGTGCCAGG + Intronic
947163872 2:227241761-227241783 CTGCATATGTACTCTGTGCCAGG + Intronic
947336470 2:229090812-229090834 TTGAACATGTACTATGTGCCAGG + Intronic
947375624 2:229492148-229492170 CTGAATGTGTACTATGTGCCAGG - Intronic
947388809 2:229619259-229619281 ATAATTATGCACTGTATGCCTGG + Intronic
1168967226 20:1906073-1906095 TTGAGTACTTACTCTGTGCCAGG + Intronic
1169390211 20:5184665-5184687 TTGAATATGTACTCTGTGCTAGG + Intronic
1169735565 20:8834090-8834112 TTGAGCATGTACTATGTGCCAGG + Intronic
1169772327 20:9215166-9215188 TTGAGCATCTACTCTGTGCCAGG + Intronic
1170202077 20:13755139-13755161 CTGAATACCTACTCTGTGCCGGG - Intronic
1170663171 20:18362673-18362695 CTGATAATCTACTTTGTGCCAGG + Intergenic
1172803224 20:37592887-37592909 CTGAGAATTTACTCTGTGCCAGG + Intergenic
1173119805 20:40278327-40278349 TTGATAATTTACTCTGTACCAGG + Intergenic
1173441235 20:43078147-43078169 TTGGTCATTTACTCTGTGCCAGG - Intronic
1173697802 20:45035890-45035912 TTGAAAATGTACTATGTGCCAGG + Intronic
1173855792 20:46249949-46249971 ATGATTGCCTACTCAGTGCCTGG + Intronic
1173862443 20:46293040-46293062 CTGAGCATCTACTCTGTGCCAGG - Intronic
1174166972 20:48591666-48591688 ATGTTTTTTTCCTCTGTGCCTGG - Intergenic
1174231879 20:49052230-49052252 CTAAATATGTACTGTGTGCCAGG + Intronic
1174321390 20:49744404-49744426 TTGAACATTTACTCTGTGCCAGG - Intergenic
1174558119 20:51411036-51411058 CTGGGTATTTACTCTGTGCCAGG + Intronic
1174622901 20:51890223-51890245 CTGAGCATGTACTGTGTGCCAGG - Intergenic
1174853320 20:54018344-54018366 ATGAGTATTTCCTTTGTGCCAGG - Intronic
1174900169 20:54491359-54491381 ATGAGTATGTATTCTATGCTAGG - Intronic
1175074540 20:56361445-56361467 ATGAGTGTCTCCTCTGTGCCAGG - Intronic
1175454705 20:59103469-59103491 ATGAATATCTCTTCTGTGCCAGG + Intergenic
1175478860 20:59297431-59297453 AGCATTATGAACTCTGTCCCTGG + Intergenic
1175635723 20:60581139-60581161 ATGACTATTTGCTATGTGCCAGG + Intergenic
1176877497 21:14147454-14147476 ATGATTATCTACACGGAGCCAGG - Intronic
1176991062 21:15496706-15496728 ATGATAACCAACTCTGTGCCCGG - Intergenic
1177238538 21:18425934-18425956 TTGATTTTATGCTCTGTGCCAGG + Intronic
1177439840 21:21108247-21108269 ATTAAAATGTACTGTGTGCCAGG + Intronic
1178137583 21:29645097-29645119 CTGATAATTTACTATGTGCCAGG + Intronic
1178158333 21:29881095-29881117 TTGATTATTTACAGTGTGCCAGG - Intronic
1178335059 21:31735131-31735153 TTGAGCATGTACTTTGTGCCAGG + Intergenic
1178344276 21:31811577-31811599 ATGAGCATTTACTGTGTGCCAGG + Intergenic
1178703115 21:34850930-34850952 TTGAGTATGTATTGTGTGCCAGG + Intronic
1178906493 21:36641382-36641404 TTGAACATTTACTCTGTGCCTGG - Intergenic
1178952565 21:36997191-36997213 TTGAGCATGTACTGTGTGCCAGG - Intergenic
1179333674 21:40429736-40429758 ATGAGTACTTACTGTGTGCCAGG - Intronic
1179722376 21:43323020-43323042 ATGAGCATGTACTATGTGCCAGG - Intergenic
1180539484 22:16429805-16429827 CTGAATATCTACTCTGTGCCAGG - Intergenic
1180612555 22:17107410-17107432 TTGATTATGTACAACGTGCCAGG + Intronic
1181667663 22:24409490-24409512 ATGATAAAATACTCTGGGCCAGG + Intronic
1181986523 22:26803725-26803747 TTGAGTATGTGCTATGTGCCAGG + Intergenic
1182156278 22:28075986-28076008 ATGAGCATGCAGTCTGTGCCAGG - Intronic
1182671265 22:31997868-31997890 ATGAGCATCTACTATGTGCCAGG + Intergenic
1182711428 22:32325664-32325686 CTGATTATCTCCTCTGCGCCGGG + Intergenic
1182785066 22:32900457-32900479 TTGAATAAATACTCTGTGCCAGG + Intronic
1182967019 22:34531894-34531916 TTGATTTTCTACTCTGTGCCAGG - Intergenic
1183008817 22:34927893-34927915 TTGAATATTTAGTCTGTGCCAGG - Intergenic
1183564671 22:38605147-38605169 ATGAATATTTACTATATGCCAGG - Intronic
1183793534 22:40095785-40095807 CTGAATACCTACTCTGTGCCAGG + Intronic
1183884100 22:40862788-40862810 TTGATTGTCTACTTTGTGCCAGG + Intronic
1184398947 22:44262444-44262466 CTGATTATCTCTTCTGTGCCGGG + Intronic
1185010120 22:48308234-48308256 GTGAGTATGAAATCTGTGCCAGG + Intergenic
949425957 3:3916207-3916229 ATGGGTATCTACTATGTGCCAGG + Intronic
949493975 3:4614415-4614437 TTGAATGTTTACTCTGTGCCAGG + Intronic
949644882 3:6081912-6081934 AGAATTATGGACTCTGGGCCTGG + Intergenic
950017463 3:9764248-9764270 ATGAGTATTTACCGTGTGCCAGG - Intronic
950238669 3:11347667-11347689 ATAATTATATACTCAGTGCCTGG - Intronic
950778125 3:15367946-15367968 TTGATTATTTATTCTGTGTCAGG - Intergenic
951586296 3:24218609-24218631 GTGAGTATCTACTATGTGCCAGG + Intronic
951595321 3:24312374-24312396 GTTAGTATTTACTCTGTGCCAGG - Intronic
952911291 3:38189695-38189717 TTGAAGGTGTACTCTGTGCCAGG + Intronic
953596046 3:44315067-44315089 CTAAATATTTACTCTGTGCCAGG - Intronic
953660246 3:44886722-44886744 TTGAGTACCTACTCTGTGCCAGG + Intronic
954235509 3:49254171-49254193 ATGAGCATATACTATGTGCCAGG - Intronic
955004063 3:54953138-54953160 CTGAATATTTACTATGTGCCTGG + Intronic
955385301 3:58474557-58474579 CTGATTGTTTACTCTGTTCCTGG - Intergenic
955904296 3:63790379-63790401 ATGTTTATGTACTCTGAATCTGG + Intergenic
956110170 3:65862333-65862355 TTGAGTATGAACTCTGTGGCAGG - Intronic
956335321 3:68156753-68156775 CTGAGTATGTGTTCTGTGCCAGG + Intronic
957226077 3:77448634-77448656 CTTAATATATACTCTGTGCCAGG - Intronic
957367684 3:79247858-79247880 ATGCTTATTTATTCTGTGTCTGG - Intronic
957421222 3:79974362-79974384 TTTATTATGCACCCTGTGCCTGG + Intergenic
957725406 3:84058643-84058665 ATAATTATTTGCTGTGTGCCAGG - Intergenic
957885758 3:86285455-86285477 ATGATTATGTACTATTTGTCGGG + Intergenic
959127014 3:102301960-102301982 ATGAGTACCTACTCTGTGTCAGG + Intronic
959161252 3:102727156-102727178 ATGAATATTTATTATGTGCCAGG - Intergenic
959277372 3:104293639-104293661 TTGAATATTTACTCTTTGCCAGG - Intergenic
959603103 3:108211065-108211087 ATGAGTATGTACTATGCACCAGG + Intronic
959785899 3:110296798-110296820 CTGATTATTTACTCTGTCCTAGG - Intergenic
959892857 3:111575989-111576011 ATGAGTATTCACTATGTGCCTGG - Intronic
960786245 3:121375064-121375086 CTGAATAAGTACTCTGTACCTGG - Intronic
960923277 3:122770365-122770387 TTGATTGTTTACTATGTGCCAGG - Intronic
961434680 3:126908758-126908780 TTGAATATTTACTCTGTGCCAGG + Intronic
961764216 3:129195839-129195861 ATCATGATGTACTCCTTGCCTGG + Intergenic
961786541 3:129350457-129350479 TTGAGTATCTACTATGTGCCAGG - Intergenic
962450111 3:135506277-135506299 TTGAGCATCTACTCTGTGCCAGG - Intergenic
962849834 3:139300014-139300036 TAGAGTATTTACTCTGTGCCAGG + Intronic
962975933 3:140445835-140445857 GTGAGCATCTACTCTGTGCCAGG + Intronic
963007611 3:140740712-140740734 ATCATGCTGCACTCTGTGCCTGG - Intergenic
963730101 3:148962972-148962994 TTGATAATTTACTATGTGCCAGG + Intergenic
965533262 3:169798164-169798186 CTGAGTTTGTCCTCTGTGCCTGG - Intronic
966253270 3:177890715-177890737 TTGAGTATCTACTATGTGCCAGG - Intergenic
966317167 3:178660586-178660608 TTTATTATCTACTCTGTGGCAGG + Intronic
966470562 3:180284110-180284132 TTGATTATTTACTATATGCCAGG + Intergenic
967322325 3:188206918-188206940 ATGAGTGTTTACTCTGTGCTAGG - Intronic
967703233 3:192619311-192619333 ATGCTTTTGTTTTCTGTGCCTGG - Intronic
968160966 3:196426489-196426511 ATGATTAAGTTCTCTGTGTCTGG - Intronic
968271029 3:197403976-197403998 ATGAGCACCTACTCTGTGCCAGG + Intergenic
968691186 4:1991172-1991194 CTGAGCATGTACTCTGGGCCAGG + Intronic
969257185 4:6010254-6010276 ATGATGAGGTACTATGAGCCAGG + Intergenic
969263789 4:6051033-6051055 ATGGTTTATTACTCTGTGCCAGG + Intronic
970352215 4:15213906-15213928 CTGAGTATAAACTCTGTGCCAGG + Intergenic
971132881 4:23833029-23833051 TTGAACATCTACTCTGTGCCAGG + Intronic
971370328 4:26013993-26014015 ACAACTATGTATTCTGTGCCAGG - Intergenic
972836613 4:42878290-42878312 TTGATTATGAGCTCTGTGCCTGG - Intergenic
973335113 4:48948188-48948210 ATTATAATGAACTCTATGCCAGG - Intergenic
973340297 4:48996449-48996471 TTGATTACTTACTCTGTGTCAGG + Intronic
973820950 4:54660849-54660871 ATGAGTTTTTACTATGTGCCAGG + Intronic
973966071 4:56163138-56163160 ATGAGCATCTTCTCTGTGCCAGG + Intergenic
973969571 4:56198596-56198618 TTTATTATCTACTGTGTGCCAGG + Intronic
974101946 4:57426697-57426719 ATGGGTGTGTACCCTGTGCCAGG - Intergenic
974335589 4:60540321-60540343 TTTATTAAGTACTGTGTGCCAGG - Intergenic
975140070 4:70909543-70909565 ATGAGTGTTTACTATGTGCCAGG + Intronic
975582736 4:75921466-75921488 TTGAATATCTACACTGTGCCAGG + Intronic
975868397 4:78750325-78750347 ATTATTATGTGCACTGTGACAGG - Intergenic
976016792 4:80565097-80565119 ATGTTTATGTACTCTTTGACCGG + Intronic
976547115 4:86349211-86349233 AAGATTATGGACTCTCTGCCAGG + Intronic
976890510 4:90040679-90040701 TTGACTATCTACTCTGAGCCAGG + Intergenic
977324533 4:95557987-95558009 TTGATTACCTTCTCTGTGCCAGG - Intergenic
977593288 4:98850648-98850670 TTGATTACCTACTGTGTGCCAGG - Intergenic
978282073 4:107029499-107029521 TTGATTATTCACTCTATGCCAGG - Intronic
979631905 4:122912229-122912251 ATGAGTTTCTACTCTGTGCCAGG - Intronic
979980252 4:127246452-127246474 ATGAGTATTTACCATGTGCCAGG + Intergenic
980034787 4:127871432-127871454 ATGAATATTTACAATGTGCCAGG - Intergenic
980303812 4:131030063-131030085 ATAAATATGTACTTTTTGCCTGG - Intergenic
980470431 4:133243280-133243302 TTGAGTATGTAGTCTATGCCAGG - Intergenic
980616432 4:135232317-135232339 ATGAATGTGTACTTTGTGTCAGG - Intergenic
980974168 4:139595165-139595187 TTGAATATTTACTATGTGCCAGG - Intronic
981595184 4:146412956-146412978 TTGAGTATTTACTGTGTGCCTGG - Intronic
981660711 4:147163418-147163440 CTGAGTATCTACTGTGTGCCAGG + Intergenic
981803461 4:148684887-148684909 ATGAATATTTATTTTGTGCCAGG + Intergenic
981936098 4:150241535-150241557 ATGAGTAGCTACTGTGTGCCAGG + Intronic
982375916 4:154690290-154690312 TTGAGCATCTACTCTGTGCCAGG + Intronic
982737986 4:159025938-159025960 TTGATTGTTTACTGTGTGCCAGG - Intronic
983518744 4:168684601-168684623 ATTAATATTTACTCTATGCCAGG - Intronic
984551526 4:181165544-181165566 ATGAGTACTTACTATGTGCCAGG + Intergenic
987713098 5:21529586-21529608 CTGAATATCTACTCTGTGCCAGG - Intergenic
988388948 5:30602410-30602432 TTGATTACATACTCTTTGCCAGG - Intergenic
988389217 5:30605812-30605834 GTCAATATTTACTCTGTGCCTGG + Intergenic
989196574 5:38722521-38722543 CTGATTATCTACTATGTGCTAGG - Intergenic
989518141 5:42367592-42367614 ATGATTAGTTACTATGTGCCAGG - Intergenic
990010964 5:50996966-50996988 TTGAGTATGTACTGTGTTCCAGG - Intergenic
990031607 5:51267007-51267029 CTGATTATTTACTTTGTGCTAGG + Intergenic
990327845 5:54695833-54695855 ATGACCTTCTACTCTGTGCCAGG + Intergenic
990388662 5:55295150-55295172 ATGATTCTGCAGTCTGTGCTGGG - Intronic
990480066 5:56201693-56201715 TTGAATATTTACTCTGGGCCAGG - Intronic
991166802 5:63572490-63572512 ATGATTCTGCAAGCTGTGCCAGG - Intergenic
991230193 5:64323731-64323753 ATAATTAATTACTATGTGCCAGG + Intronic
991499171 5:67258988-67259010 ATGAGTATCTACTGTGTGCTAGG + Intergenic
992738831 5:79752176-79752198 ATGTTTATTTACTATGTCCCAGG - Intronic
994252076 5:97547730-97547752 ATGAGCCTGTGCTCTGTGCCAGG - Intergenic
995701073 5:114936576-114936598 ATGATTGTCTACTATGTGCCAGG + Intergenic
996630019 5:125619541-125619563 GTGATTATCTACTACGTGCCAGG + Intergenic
996672160 5:126130907-126130929 TTGAGTATCTACTATGTGCCAGG + Intergenic
997167591 5:131677412-131677434 ATGATTTTGTACTTTGTGTTAGG - Intronic
997719965 5:136070403-136070425 TTGAATACGTACTGTGTGCCAGG - Intergenic
997838049 5:137212501-137212523 CTGAATATGTACTATGTGTCAGG + Intronic
998733135 5:145104054-145104076 TTGACCAAGTACTCTGTGCCAGG + Intergenic
998814701 5:146001572-146001594 TTTATTATTTACTTTGTGCCAGG + Intronic
998985206 5:147749263-147749285 TTGAATATTTACTATGTGCCAGG + Intronic
999416361 5:151399863-151399885 ATCATTGTTTACTTTGTGCCTGG + Intergenic
999610611 5:153365138-153365160 ATGAGTACGTAGTATGTGCCAGG - Intergenic
999938217 5:156511794-156511816 CTGATCATGTACTATGTGCTAGG - Intronic
1000280169 5:159775131-159775153 CTGAGTATTTACTGTGTGCCAGG + Intergenic
1000332570 5:160217543-160217565 ACTCTTATATACTCTGTGCCAGG + Intronic
1000342619 5:160289302-160289324 ATTAGTACTTACTCTGTGCCAGG - Intronic
1001275851 5:170350941-170350963 ATTATCATGGACTCTGTTCCAGG - Intergenic
1001279438 5:170376063-170376085 GTGCTTATTTATTCTGTGCCAGG - Exonic
1001300493 5:170530150-170530172 ATGAGCACCTACTCTGTGCCAGG - Intronic
1001489201 5:172143810-172143832 ATGATGATGTACTAGGTCCCGGG - Intronic
1001780344 5:174363348-174363370 TTGAGCATGTACTCTGGGCCAGG - Intergenic
1002479230 5:179488503-179488525 TTGATTATCTACTATGTGCTTGG - Intergenic
1003332212 6:5138721-5138743 ATGACTATGGACTTTATGCCTGG + Intronic
1003565112 6:7216116-7216138 TTGAGTTTGTACTGTGTGCCAGG + Intronic
1003844664 6:10160710-10160732 CTTATCATTTACTCTGTGCCTGG + Intronic
1003951323 6:11118457-11118479 TTGAGTATCTACTTTGTGCCAGG + Intronic
1004048786 6:12052529-12052551 TTGAGTATCTACTCTGTGTCTGG + Intronic
1004755912 6:18609972-18609994 ATGAATACCAACTCTGTGCCAGG - Intergenic
1005190111 6:23211490-23211512 TTGAGCATCTACTCTGTGCCAGG - Intergenic
1005252579 6:23964337-23964359 ATGAGTATCTTCTGTGTGCCAGG - Intergenic
1005432128 6:25769287-25769309 CTGAACATGTACTATGTGCCAGG + Intronic
1005741111 6:28791418-28791440 ATGCTTTTGAACTCTGTGCAAGG + Intergenic
1006618718 6:35347451-35347473 TTCATTATCTCCTCTGTGCCAGG - Intronic
1007272471 6:40648908-40648930 ATGATTCTGGTCTCTGGGCCAGG + Intergenic
1007324875 6:41052363-41052385 TTGAGTATCTACTCTATGCCAGG - Intronic
1007663305 6:43499579-43499601 TTGAATATGTACTCCCTGCCAGG + Intronic
1008032222 6:46709760-46709782 TTGAGTACCTACTCTGTGCCAGG + Intronic
1008151109 6:47952431-47952453 CTGAGTATATACTTTGTGCCAGG - Intronic
1008321952 6:50125272-50125294 ATGTTTATGTTTTATGTGCCTGG + Intergenic
1008460659 6:51765818-51765840 AGGAATATTTACTATGTGCCAGG - Intronic
1009003621 6:57752329-57752351 CTGAATATCTACTCTGTGCCAGG + Intergenic
1009855055 6:69251480-69251502 ATGAGTGTGTGCTATGTGCCAGG - Intronic
1010249600 6:73694266-73694288 TTGAATAGCTACTCTGTGCCAGG + Intergenic
1010671063 6:78687164-78687186 ATGAGCACGTACTCTGTGCCAGG + Intergenic
1011516229 6:88156716-88156738 TTGAATACCTACTCTGTGCCAGG - Intronic
1011648055 6:89479029-89479051 ATGAATATTTACTTTGTGCTAGG + Intronic
1012812491 6:103978073-103978095 TTGAATATTTTCTCTGTGCCAGG + Intergenic
1013396860 6:109749750-109749772 ATCATAATGTATTCTTTGCCAGG + Intronic
1013444634 6:110211556-110211578 TTGAGTACTTACTCTGTGCCAGG + Intronic
1013520318 6:110926817-110926839 ATGAATATTTACTATGTGCCAGG - Intergenic
1014500325 6:122180727-122180749 ATGAGTACCTACTCTGTGCCAGG - Intergenic
1014652656 6:124059583-124059605 CTGAATATCCACTCTGTGCCAGG - Intronic
1015053460 6:128870774-128870796 TTGATTGTGTGCTCTGTCCCTGG + Intergenic
1015684969 6:135849534-135849556 TTGATTGTGTACTCTGTACCAGG - Intergenic
1015704887 6:136077024-136077046 CTTCTTATGTACCCTGTGCCAGG + Intronic
1016350264 6:143159162-143159184 AGCATTTTCTACTCTGTGCCAGG - Intronic
1016470293 6:144368332-144368354 TTGAGCATCTACTCTGTGCCAGG - Intronic
1017082063 6:150679653-150679675 TTGAGTATGTACTCTGTGCCAGG + Intronic
1018199464 6:161381747-161381769 ATGAGCACCTACTCTGTGCCAGG + Intronic
1018325849 6:162667908-162667930 TTGAGTATTTACTATGTGCCAGG - Intronic
1018478366 6:164166107-164166129 AACATTGTGTACTTTGTGCCAGG - Intergenic
1018848437 6:167571199-167571221 ATGTTTGTGAACTGTGTGCCCGG + Intergenic
1019073470 6:169368411-169368433 ATGGTTCTGTCCTCTGAGCCTGG - Intergenic
1019102413 6:169641898-169641920 CTGAGAATCTACTCTGTGCCAGG + Intronic
1020916646 7:14201862-14201884 TTGATTGTCTGCTCTGTGCCAGG - Intronic
1021252221 7:18344274-18344296 TTGATTATGTACTATGTGGTAGG + Intronic
1021914356 7:25416582-25416604 CTGAGCATCTACTCTGTGCCAGG - Intergenic
1021923832 7:25515340-25515362 ATAAATGTTTACTCTGTGCCAGG - Intergenic
1022024383 7:26432524-26432546 ATGAGTCTTTACTATGTGCCAGG - Intergenic
1022243917 7:28539221-28539243 CTGAGTATTTACTATGTGCCAGG - Intronic
1022823374 7:33983485-33983507 CTGAATGTGTACCCTGTGCCAGG + Intronic
1022972839 7:35532988-35533010 TTGATTACCTACTATGTGCCAGG + Intergenic
1023491786 7:40750884-40750906 CTGAGTATATACTATGTGCCAGG + Intronic
1023501169 7:40850944-40850966 TTGAGTATTTACTGTGTGCCTGG + Intronic
1024496092 7:50047448-50047470 TTGTATATGTACTCTGTGTCTGG - Intronic
1025232963 7:57215043-57215065 ATGATTATTTACAATGTGCAAGG + Intergenic
1026107404 7:67432150-67432172 TTGATTATCTCCTCTGGGCCAGG + Intergenic
1026561374 7:71453117-71453139 ATGTTTATTTACTCTATTCCAGG - Intronic
1027593775 7:80146836-80146858 ATGAATGTTTACTCTGTGCAAGG - Intronic
1028458464 7:91064026-91064048 ATGATTAAGTAATCTGTTCAAGG + Intronic
1029012855 7:97281101-97281123 TTGAATATCTATTCTGTGCCTGG + Intergenic
1029332024 7:99865666-99865688 TTGAGTATCTATTCTGTGCCAGG - Intronic
1029794884 7:102883248-102883270 TTGATTATCTAGTATGTGCCAGG - Intronic
1030655651 7:112164497-112164519 TGGATTACTTACTCTGTGCCAGG + Intronic
1030693974 7:112564245-112564267 TTGAGCATGTACTCTGTGCTGGG + Intergenic
1031644337 7:124204804-124204826 TTGATTATCTACTATGTGCTTGG - Intergenic
1032126259 7:129195804-129195826 AACATTATGTACTGTGGGCCAGG + Intronic
1032728413 7:134613764-134613786 TTGAATATCTACTCTGTGCCAGG - Intergenic
1032753194 7:134863287-134863309 TTGAATATGTACTATGTGGCAGG - Intronic
1032872340 7:135999706-135999728 TTAAGTATGTACTCTGTGCCAGG + Intergenic
1032940405 7:136782139-136782161 GTGAGTATGTACTCTGTGTCAGG - Intergenic
1033021994 7:137734869-137734891 TTGATCACGCACTCTGTGCCAGG - Intronic
1033445365 7:141416820-141416842 CTCGTTATGTACTCTGTGTCTGG - Intronic
1034102308 7:148460214-148460236 ATGACTGAGTGCTCTGTGCCTGG + Intergenic
1037445614 8:18962744-18962766 ATGACTATATACTATGAGCCAGG + Intronic
1037794551 8:21981069-21981091 TTGAATACCTACTCTGTGCCAGG + Intronic
1038227722 8:25672299-25672321 CTGATTATTTACCGTGTGCCAGG + Intergenic
1038395048 8:27240436-27240458 ATGATCTTATACTATGTGCCAGG + Intronic
1038560558 8:28575416-28575438 CTGATTATCTACTATGTGCCAGG + Intergenic
1039031357 8:33313019-33313041 CTGAGTACATACTCTGTGCCAGG + Intergenic
1039935793 8:42043999-42044021 GTGTTTATTTACTATGTGCCAGG - Intronic
1041276074 8:56158707-56158729 TTGATTATCTACCCTGTGCTTGG + Intergenic
1041559363 8:59197214-59197236 TTGAGCATGTACTCTGTGCCAGG - Intergenic
1041756743 8:61322131-61322153 ATGAGCACCTACTCTGTGCCAGG - Intronic
1042617087 8:70661451-70661473 TTGAGCATTTACTCTGTGCCAGG - Exonic
1042648972 8:71018627-71018649 CTGAGTACGTACTATGTGCCAGG - Intergenic
1043399157 8:79866744-79866766 TTGAGTGTGTCCTCTGTGCCGGG + Intergenic
1043512709 8:80965459-80965481 CTGAGTATTTACTATGTGCCAGG - Intergenic
1043776886 8:84280581-84280603 ATGGTGATGTACTCTGTGTGTGG - Intronic
1043793937 8:84511373-84511395 TTGAAAATGTACTATGTGCCAGG - Intronic
1044255201 8:90052009-90052031 TTGAATATGTATTATGTGCCAGG + Intronic
1044988377 8:97774695-97774717 ATGATTAAAAACGCTGTGCCAGG + Intergenic
1045058043 8:98385861-98385883 ATGATTGTGTATTCTGTGGCTGG + Intergenic
1045269853 8:100652364-100652386 ATTTTAATTTACTCTGTGCCTGG + Intronic
1045373507 8:101549015-101549037 ATGGTTATGTCCTCAATGCCTGG - Intronic
1045749803 8:105469903-105469925 TTGAGCATTTACTCTGTGCCAGG - Intronic
1045871146 8:106928262-106928284 TTGATCACTTACTCTGTGCCAGG + Intergenic
1046782557 8:118231157-118231179 TTTATCATCTACTCTGTGCCAGG - Intronic
1047123256 8:121930314-121930336 CTGAGTATTTACTCTATGCCAGG - Intergenic
1047183605 8:122612607-122612629 TTGAGTGTGTACTCTATGCCAGG + Intergenic
1047190343 8:122673728-122673750 CTGATTCTGTTCTGTGTGCCGGG - Intergenic
1047395235 8:124491612-124491634 ATGAATAGGTACACTGTGCCTGG - Intronic
1047985554 8:130229612-130229634 TTGAATACCTACTCTGTGCCAGG - Intronic
1048063035 8:130940067-130940089 TTGAGCATGTACTATGTGCCAGG + Intronic
1048211041 8:132454349-132454371 AAAATTATGTACAGTGTGCCCGG + Intronic
1048376788 8:133829638-133829660 ATGAGTGTCTACTATGTGCCTGG - Intergenic
1048629465 8:136226291-136226313 CTGATTTCGTGCTCTGTGCCAGG - Intergenic
1049231615 8:141487838-141487860 TTGCGTATGTGCTCTGTGCCAGG + Intergenic
1050057221 9:1668219-1668241 CTGAGTATCTACTCTGTGTCAGG - Intergenic
1051628403 9:19120380-19120402 ATCATTAGGTAATGTGTGCCAGG - Intronic
1052016545 9:23475038-23475060 TGGAGTATGTACTATGTGCCAGG - Intergenic
1052050339 9:23840221-23840243 ATGAAGATTGACTCTGTGCCAGG - Intergenic
1053008086 9:34617344-34617366 ATGATCATCTACTCTGATCCAGG - Intronic
1053103740 9:35393057-35393079 TTGAATATTTTCTCTGTGCCTGG + Intronic
1054784333 9:69196377-69196399 TTGAGCATGTACTATGTGCCAGG + Intronic
1054862597 9:69968972-69968994 ATTATTATGTACTGTGTGCCAGG - Intergenic
1055281481 9:74679576-74679598 ATGAATAGGTACTACGTGCCAGG + Intronic
1056210811 9:84363516-84363538 ATGATCACTTCCTCTGTGCCAGG + Intergenic
1056505547 9:87254854-87254876 GTGAATGTTTACTCTGTGCCAGG + Intergenic
1057125381 9:92612114-92612136 AAGCTTATGTACTGTGTGCCAGG - Intronic
1057822002 9:98339710-98339732 TTGAGTATGTACTATGTGCCAGG + Intronic
1058329914 9:103747325-103747347 TTGAGTATTTTCTCTGTGCCAGG - Intergenic
1058657597 9:107237817-107237839 TTGGGTTTGTACTCTGTGCCAGG - Intergenic
1059019201 9:110555272-110555294 ATGAACATGTACTCTGTGCCCGG - Intronic
1059067345 9:111099411-111099433 CCGATTATATACTCTGTCCCAGG + Intergenic
1059158947 9:112015573-112015595 ATGAGCATTTACTATGTGCCAGG + Intergenic
1059395931 9:114034105-114034127 CTGAGTATGTAATCTGTGCCAGG - Intronic
1060154345 9:121308836-121308858 ATGATGATGCCCACTGTGCCGGG - Intronic
1060187784 9:121574528-121574550 ATGAGCATTTACTGTGTGCCTGG + Intronic
1060368657 9:123046523-123046545 ACGATTATGTACTTTGCCCCAGG - Intronic
1060423970 9:123489355-123489377 AGGATCATCTACTCAGTGCCAGG - Intronic
1060864620 9:126985841-126985863 TTTATTATGTACTGTGTTCCAGG - Intronic
1187765600 X:22638295-22638317 ATGATCACGTACCATGTGCCAGG - Intergenic
1188052097 X:25500184-25500206 AGGATCATATACTATGTGCCAGG - Intergenic
1188631773 X:32372257-32372279 ATGAGTATGTCCTATGTGTCAGG + Intronic
1188636215 X:32435406-32435428 TTGAATATGTACTGTGTTCCTGG + Intronic
1188749019 X:33883029-33883051 TTGAATATGTACTATGTGTCAGG - Intergenic
1188963620 X:36523877-36523899 ATCATTATATACTGTGTGTCAGG - Intergenic
1189092162 X:38095324-38095346 TTGAGTACGTACTCTGTGTCAGG + Intronic
1189845417 X:45132027-45132049 TTGAGTATTTACTGTGTGCCAGG - Intergenic
1190874157 X:54447970-54447992 AAGAGTACTTACTCTGTGCCAGG - Intronic
1192487042 X:71536713-71536735 ATGGTTATGTATGCTGTGGCAGG + Intronic
1193439993 X:81528539-81528561 ATGATTATGTGCTTTGTGGATGG + Intergenic
1193846735 X:86480571-86480593 TTGATACTGTACTCTGAGCCTGG - Intronic
1194172618 X:90606210-90606232 ATGAATACATACTCTATGCCAGG + Intergenic
1194434407 X:93852118-93852140 TTGAGTATTTACTATGTGCCTGG + Intergenic
1194616931 X:96115870-96115892 ATTGATATCTACTCTGTGCCAGG - Intergenic
1194775227 X:97954935-97954957 TTGAATATTTACTATGTGCCAGG + Intergenic
1195726176 X:107919015-107919037 ATGATTATCTACTGGGTGTCTGG - Intronic
1195779277 X:108442779-108442801 ATGAGTGTTTACTATGTGCCAGG + Intronic
1195963842 X:110412621-110412643 ATTATTAAATGCTCTGTGCCAGG - Intronic
1195996945 X:110741101-110741123 AAGAGTATGTACTCTTTACCTGG - Intronic
1196886116 X:120247161-120247183 TTTAGTATTTACTCTGTGCCAGG - Intergenic
1197973834 X:132143928-132143950 TTGAGTGTGTACTGTGTGCCAGG - Intergenic
1198590322 X:138173210-138173232 ATGAATGTTTACTATGTGCCAGG - Intergenic
1198977818 X:142356931-142356953 CTGAGAATCTACTCTGTGCCAGG + Intergenic
1199199824 X:145074371-145074393 TTGATCATCTTCTCTGTGCCAGG + Intergenic
1199296444 X:146164284-146164306 TTGAATATTTTCTCTGTGCCAGG - Intergenic
1199431517 X:147766153-147766175 CTGAATATCTACTATGTGCCTGG + Intergenic
1200334562 X:155335809-155335831 ATGAATGTCAACTCTGTGCCAGG + Intergenic
1200361368 X:155610914-155610936 ATGAATGTCAACTCTGTGCCAGG - Intronic
1200518847 Y:4183947-4183969 ATGAATACATACTCTATGCCAGG + Intergenic
1201180687 Y:11341443-11341465 CTGAATACCTACTCTGTGCCAGG - Intergenic
1201719474 Y:17080968-17080990 AAGAATCTGTTCTCTGTGCCTGG + Intergenic
1202056089 Y:20831845-20831867 ATCATTATGTTTTCTGTGCAAGG - Intergenic