ID: 1118582719

View in Genome Browser
Species Human (GRCh38)
Location 14:67319402-67319424
Sequence CTCATTTTGATTCATGACTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 180}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118582717_1118582719 -6 Left 1118582717 14:67319385-67319407 CCTGTCATAATTTATACCTCATT 0: 1
1: 0
2: 1
3: 18
4: 177
Right 1118582719 14:67319402-67319424 CTCATTTTGATTCATGACTCTGG 0: 1
1: 0
2: 0
3: 11
4: 180
1118582715_1118582719 -2 Left 1118582715 14:67319381-67319403 CCCACCTGTCATAATTTATACCT 0: 1
1: 0
2: 1
3: 13
4: 161
Right 1118582719 14:67319402-67319424 CTCATTTTGATTCATGACTCTGG 0: 1
1: 0
2: 0
3: 11
4: 180
1118582716_1118582719 -3 Left 1118582716 14:67319382-67319404 CCACCTGTCATAATTTATACCTC 0: 1
1: 0
2: 0
3: 10
4: 132
Right 1118582719 14:67319402-67319424 CTCATTTTGATTCATGACTCTGG 0: 1
1: 0
2: 0
3: 11
4: 180
1118582714_1118582719 -1 Left 1118582714 14:67319380-67319402 CCCCACCTGTCATAATTTATACC 0: 1
1: 0
2: 0
3: 3
4: 124
Right 1118582719 14:67319402-67319424 CTCATTTTGATTCATGACTCTGG 0: 1
1: 0
2: 0
3: 11
4: 180

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118582719 Original CRISPR CTCATTTTGATTCATGACTC TGG Intronic
901533610 1:9868454-9868476 CTCATTTTTATTCTTAACTGTGG + Intronic
902104237 1:14020283-14020305 CTGATATTGGTTCATGGCTCAGG + Intergenic
902161448 1:14533766-14533788 CTCCTTTTGATAAATGACTCTGG + Intergenic
904351429 1:29909644-29909666 CTCATTTTGATTCCTAATTCTGG + Intergenic
906859368 1:49342458-49342480 CTCATTTTGTTTTATGTCTTTGG + Intronic
908948818 1:69534687-69534709 TTATTTGTGATTCATGACTCAGG + Intergenic
911994281 1:104744399-104744421 TTATTTTTGATACATGACTCTGG - Intergenic
914289466 1:146259675-146259697 CACATTTGGATTTATGGCTCAGG - Intergenic
914312659 1:146480439-146480461 CTCATTTTAATGCCTAACTCTGG + Intergenic
914501689 1:148252899-148252921 CTCATTTTAATGCCTAACTCTGG - Intergenic
914550502 1:148710428-148710450 CACATTTGGATTTATGGCTCAGG - Intergenic
914864094 1:151411296-151411318 CTCATTCTTATTCATCCCTCAGG + Intronic
917784156 1:178434435-178434457 CTCATTTTGAGTGACAACTCAGG + Intronic
919958582 1:202442664-202442686 TTCATTTTGATTCATTTCTGCGG - Intronic
1062962747 10:1585701-1585723 CTGATATTGATTGATGTCTCAGG + Intronic
1064787981 10:18919467-18919489 CTCATTTTGATTAAGTAATCTGG - Intergenic
1065520143 10:26564432-26564454 CTCATTATGACTCGTGTCTCAGG - Intronic
1067559167 10:47292791-47292813 CTGATTTTGATTTATTAATCTGG + Intergenic
1067650526 10:48150833-48150855 CTCATTTTGAGTCATATATCAGG - Intergenic
1067914037 10:50377122-50377144 TTTATTTTGGTTCATGATTCTGG + Intronic
1070401070 10:76054074-76054096 CTCATGTTGGTACTTGACTCAGG + Intronic
1070471429 10:76784020-76784042 CTCATTTTGCGTCAGGAATCTGG - Intergenic
1075031658 10:119028733-119028755 CACATTTTGACTCAGGCCTCTGG + Intergenic
1075846407 10:125548546-125548568 CTCAGCTTGTTTCCTGACTCAGG + Intergenic
1077616159 11:3675618-3675640 CCCATTTTGTTTCCTAACTCAGG + Exonic
1078875914 11:15396944-15396966 CCCATTTCAATTAATGACTCTGG - Intergenic
1088349332 11:108867005-108867027 CTCATCTTGATTGATGCTTCAGG - Intronic
1091107098 11:132932938-132932960 CTCATTTTGAATCCCAACTCTGG - Intronic
1091215127 11:133896633-133896655 CTCATTTTGATTTGTAATTCAGG + Intergenic
1093409493 12:18847169-18847191 ATCTTTTTGATTCATGATACTGG - Intergenic
1095091722 12:38113767-38113789 CACAAATTGATTCATGTCTCTGG + Intergenic
1095143276 12:38693103-38693125 CTCATGTTCATTCATGTCTTGGG - Intronic
1095211557 12:39500744-39500766 CACATTTTGACCCTTGACTCGGG + Intergenic
1095313836 12:40734062-40734084 CTGACTTTGATTCATGAATATGG - Intronic
1097822472 12:64142109-64142131 ATCATTTTGATTCTTGATTCAGG - Intronic
1097949457 12:65411014-65411036 CTCATTTTGTTTAATGTCTTGGG + Intronic
1100698080 12:97117199-97117221 TTCATTTTGCTTCTTGGCTCTGG + Intergenic
1101183432 12:102246427-102246449 TTCATTTTGATTCATTAATATGG + Intergenic
1104305306 12:127605045-127605067 CCTATTTTGGCTCATGACTCTGG + Intergenic
1108206692 13:48097022-48097044 GTCATATTGAGCCATGACTCTGG + Intergenic
1110018997 13:70444972-70444994 CTCTCTTTGATTCATGTCACTGG - Intergenic
1110336407 13:74336545-74336567 CTCATTTGGATGCTTGACTGGGG - Intergenic
1111587080 13:90294710-90294732 TTCATTTTGATACATGTCCCTGG + Intergenic
1117986530 14:61391569-61391591 GTCTTTTTGGTTCATGACTGTGG + Intronic
1118582719 14:67319402-67319424 CTCATTTTGATTCATGACTCTGG + Intronic
1118588663 14:67382605-67382627 TTCATTTTTAATAATGACTCAGG + Intronic
1119009789 14:70972691-70972713 CTCATTTTGTCACATGATTCAGG + Intronic
1119532024 14:75368924-75368946 CTCAATTTGGCTCATGATTCTGG + Intergenic
1119957623 14:78816934-78816956 ATCATTGTCATTCATGACTTTGG + Intronic
1120114933 14:80604159-80604181 CTATTTTAGATTCATGACTCTGG - Intronic
1120509082 14:85391341-85391363 CTCATTTTCATATATGATTCAGG - Intergenic
1121343467 14:93118361-93118383 CCCATTTTGCTGCATGACTGGGG + Intergenic
1123924220 15:25092249-25092271 CTCATTTTTTTTCATGGCTGAGG + Intergenic
1124830130 15:33140481-33140503 CCGATGTTGATTCACGACTCAGG + Intronic
1127463834 15:59224992-59225014 CAAATTTTGATTCCTAACTCTGG + Intronic
1128225477 15:65998539-65998561 CTCATTGTTATTTATGTCTCTGG + Intronic
1129062908 15:72874486-72874508 AACATTGAGATTCATGACTCTGG - Intergenic
1129952035 15:79600455-79600477 CTCATTTTTGGTCATGACTAAGG + Intergenic
1136621588 16:31432754-31432776 CTCAGTTTGCCTCATGACTGGGG + Intronic
1140760356 16:78103650-78103672 CCCCTTTTCATTCCTGACTCTGG + Intronic
1140988754 16:80187412-80187434 CTCCTTTTGAGTCCTTACTCAGG + Intergenic
1141556173 16:84838100-84838122 CTCTTATTCATTCAGGACTCAGG - Intronic
1142805751 17:2370272-2370294 CTCACTTTGCTTCATGTCTGTGG + Intronic
1144512457 17:15888757-15888779 CTCTTATTTATTCATGACTTTGG + Intergenic
1148635167 17:49143551-49143573 TTCCTTTTGATTCATGAGTTAGG - Intronic
1150023677 17:61648309-61648331 TTCATTTTCATTCATGGCTGTGG + Intergenic
1150034162 17:61775675-61775697 CTCATTTTACTTCATGTATCTGG - Intronic
1150199810 17:63343421-63343443 CTATTTTTGATTCATGAATTTGG - Intronic
1153050358 18:897467-897489 ATCATTTTAATTAATGACTTAGG + Intergenic
1153982591 18:10323003-10323025 CTCCTTTTGTTTCATGACAGTGG + Intergenic
1157029834 18:43892530-43892552 CTCATTTCCATTTATGAATCAGG + Intergenic
1159487350 18:69080219-69080241 AGCATTTTGATTCATGACTTAGG - Intergenic
1159674772 18:71268867-71268889 CTCATTCTGAATCATGGATCAGG + Intergenic
1159713058 18:71787245-71787267 CTCATTCTGATTATTGACTTGGG - Intronic
1160113129 18:76052717-76052739 CTCATGTTAATTCGTGGCTCGGG - Intergenic
1160113252 18:76053779-76053801 CTCATGTTAATTCGTGGCTCAGG - Intergenic
1164074812 19:21804940-21804962 CCAATGTTTATTCATGACTCAGG + Intronic
1167765511 19:51479666-51479688 CTCACTTCTATTCATCACTCAGG - Intronic
1168534575 19:57158323-57158345 CTCACTTGGACTCTTGACTCTGG + Exonic
926160538 2:10486109-10486131 CTGATTTTAATTCATGTCTGTGG + Intergenic
927603002 2:24460900-24460922 CCCATTTTAATTCATCGCTCAGG + Intergenic
927836672 2:26404548-26404570 CTCCTTTTAATTCATGGGTCTGG - Intronic
928896544 2:36271715-36271737 CTCATTTTGCTTCTTGACTTTGG - Intergenic
929371473 2:41228983-41229005 CTCATTTTGGTTCATTTCTGTGG - Intergenic
931531309 2:63217544-63217566 TTCATTTTCATTCATGATTTAGG + Intronic
933334544 2:80940223-80940245 CTGATTTTAATTCTTGACTGAGG - Intergenic
933406476 2:81866331-81866353 ATCATTTACATTCAAGACTCAGG - Intergenic
933617856 2:84501914-84501936 CTCTTTTTTCTTCATTACTCTGG + Intergenic
934121719 2:88846618-88846640 CTCATTTTGAATCCTGATTTGGG + Intergenic
935946439 2:108290535-108290557 TTTATTTTGAATCATGATTCTGG + Intronic
936107953 2:109641657-109641679 CTAATTTGGATTCATGCATCTGG - Intergenic
936406179 2:112206219-112206241 CCCATTTTCATTCCTGACACTGG + Intergenic
936814273 2:116441002-116441024 CTCATTTTGATTCTTTTCACAGG + Intergenic
939026120 2:137015481-137015503 CTCAATTCCATGCATGACTCTGG - Intronic
939235346 2:139485196-139485218 CACATGTTGATTGATGTCTCAGG + Intergenic
941606046 2:167597649-167597671 CTCATTCTAATTCATGTGTCAGG - Intergenic
944328268 2:198433139-198433161 CTCATTTTTCTTCATGCCACAGG - Intronic
944591687 2:201223587-201223609 CTCATTTTCATTCTAAACTCCGG + Intronic
948183926 2:236004157-236004179 CTCATTTTGTCTCCTGACTGTGG + Intronic
1182698340 22:32211472-32211494 CTCATTTTCTTTCATTGCTCCGG + Intergenic
1182911175 22:33985861-33985883 CTCATTTAGATTCCTCTCTCTGG - Intergenic
1184317985 22:43713087-43713109 CTCATTTAGATTTAAGACTAAGG - Intronic
950361392 3:12451915-12451937 CTCTTTTAGATTCCTCACTCGGG - Intergenic
953340439 3:42130011-42130033 TTCATTTTTTTTCATGGCTCAGG + Intronic
953587601 3:44218495-44218517 CTCTTTTCTATTCATGAGTCGGG - Intergenic
954161008 3:48722365-48722387 CTCATTTTTATTCATTTCTAGGG - Intronic
954168816 3:48782929-48782951 CTTAATCGGATTCATGACTCAGG - Intronic
957643280 3:82886430-82886452 CTCATTTTGATATGTTACTCTGG - Intergenic
958506186 3:94980348-94980370 CTTATTTTGTTTCATGAAACAGG + Intergenic
958906045 3:99943353-99943375 CACATTTGGATTAATAACTCCGG + Intronic
960483469 3:118222369-118222391 CCCAATTTGATTAATGAATCAGG - Intergenic
964178983 3:153860499-153860521 CTCATTTGGAGTAATGACACTGG + Intergenic
965072576 3:163934539-163934561 CTCAATTTCAGTCAAGACTCAGG + Intergenic
965162767 3:165155939-165155961 CTGATTTTGAATCCTAACTCTGG + Intergenic
967283226 3:187842789-187842811 ATCATTTTGATTTTTTACTCTGG + Intergenic
968192434 3:196679084-196679106 CTCATTTTAATTCCTGACATTGG - Intronic
968398954 4:271210-271232 CTTATATTTATTCAGGACTCTGG + Exonic
970651858 4:18187468-18187490 CTCCATTTGCTTCATGACTCCGG - Intergenic
972195659 4:36650750-36650772 CTCAAATTGATTCAGCACTCAGG + Intergenic
973258512 4:48137175-48137197 CTCATTTCTATTCATTCCTCAGG - Exonic
973291216 4:48472549-48472571 CTCATTATGCTTCCTGAATCTGG + Intergenic
973339443 4:48988362-48988384 GTCATTCTTCTTCATGACTCTGG - Intronic
975269115 4:72408583-72408605 ATCATTTTTATTTATAACTCAGG - Intronic
976032260 4:80770710-80770732 CTCATTTGGAATCATAACTAAGG + Intronic
977974598 4:103249825-103249847 CTCTTTTTGCTTCATGGGTCTGG - Intergenic
978005986 4:103617151-103617173 CTCATTTTGTTTCTTGACTATGG - Intronic
982026370 4:151256492-151256514 ATCATTTTGAATCATGATTAAGG - Intronic
984309551 4:178039554-178039576 GTCATTTTAATTAATTACTCAGG - Intergenic
984578731 4:181484235-181484257 ATCATTTTGCTTGATCACTCGGG + Intergenic
986742875 5:10719220-10719242 CTCATTTTGATGTGTTACTCTGG + Intronic
986988051 5:13521374-13521396 CACATATTGATTGATGTCTCAGG + Intergenic
987605662 5:20132633-20132655 CTCATTTTTATTAGTTACTCTGG + Intronic
987893175 5:23910252-23910274 TTCACTGTGATTCATGACACTGG - Intergenic
988383018 5:30523929-30523951 CTGTTTTTCATTCATTACTCAGG + Intergenic
988470897 5:31537236-31537258 AAGATTTTGATTCATGACTTTGG + Intronic
989636695 5:43543539-43543561 GGCATTTTGCTTCATGACTTTGG + Intronic
991584476 5:68187961-68187983 CCCATTGTGATTCAAGATTCGGG - Intergenic
994795064 5:104287985-104288007 CTCTTTTTTATTCTTGACACTGG + Intergenic
995486561 5:112645796-112645818 CACATTTAGATACATGAGTCAGG + Intergenic
997855257 5:137367518-137367540 CTCAATTTGAGACATGCCTCAGG + Intronic
1002444675 5:179282425-179282447 CTCATATTGATTCTTGACAAAGG - Intronic
1004332731 6:14736390-14736412 CACATTTTGATTGATTACACTGG + Intergenic
1004675131 6:17834269-17834291 TTCATTTTCATTCAGGACACTGG - Intronic
1004741769 6:18468743-18468765 CTCATGTTGATTCATGATCCAGG + Exonic
1004814572 6:19299004-19299026 TTCATTTTGCTTAAAGACTCAGG - Intergenic
1004863116 6:19826319-19826341 GTGATTTTTATTCATGACACAGG + Intergenic
1004990610 6:21133562-21133584 TTCATTTTGATTGATGGTTCTGG + Intronic
1011897375 6:92246744-92246766 CTATTTTTGATTAATCACTCTGG - Intergenic
1011926271 6:92649129-92649151 TTTATTGTGATTCATGAATCAGG - Intergenic
1012185079 6:96203757-96203779 CTCATTGTAATACTTGACTCTGG - Exonic
1015876614 6:137828909-137828931 CTCTTTTTATTTCATGATTCAGG + Intergenic
1018598090 6:165505560-165505582 CTCATTTTTATGCAGAACTCAGG - Intronic
1020590855 7:10134937-10134959 CTCGATTTGATCCCTGACTCTGG + Intergenic
1020851133 7:13353880-13353902 CTCATTTTTAATCATCCCTCTGG - Intergenic
1020870107 7:13618334-13618356 CTGATTTTTATTCAAGTCTCAGG - Intergenic
1020886828 7:13828576-13828598 CCCATTATGATTAAGGACTCAGG - Intergenic
1021013465 7:15501832-15501854 CTCATTTTGATTTATTTCCCTGG - Intronic
1022957741 7:35396929-35396951 CACAATTTTATTCATGTCTCTGG - Intergenic
1023155505 7:37247666-37247688 CTCCTTTTCTTTCATGACTTTGG - Intronic
1023461204 7:40399114-40399136 CTGATTTTGATGCATCAGTCAGG + Intronic
1026608643 7:71837659-71837681 CTTGTTTTGATTCATGTCTCAGG - Intronic
1028305932 7:89264488-89264510 CTCACTTTGATATTTGACTCCGG + Intronic
1030062333 7:105632601-105632623 CTCATTTTCATTCATCATACTGG - Intronic
1030124902 7:106144380-106144402 TTCATTTTTATTCAGAACTCAGG + Intergenic
1030434905 7:109505115-109505137 CTCATTTTGACTCATCACAGTGG + Intergenic
1032539063 7:132688269-132688291 CTCATTTGGGTTGATGACCCTGG - Intronic
1034286412 7:149885992-149886014 TTCATTTTTATTGATGAATCAGG + Intergenic
1037161904 8:15782874-15782896 TTTATTTTGACTCATTACTCTGG - Intergenic
1038725623 8:30079934-30079956 GTGATTTTGATTTATGAGTCTGG - Intronic
1039626572 8:39060438-39060460 CTCATTTGGTTGCATAACTCTGG - Intronic
1039743973 8:40407129-40407151 TTCCATTTGATCCATGACTCTGG - Intergenic
1040732169 8:50461536-50461558 ATCATTTTGATAAATCACTCTGG + Intronic
1041288491 8:56284764-56284786 CTCATTTTCATTGAAGACACAGG + Intergenic
1041365406 8:57097612-57097634 ATGATTCTGATTCATGAATCAGG + Intergenic
1042022364 8:64380973-64380995 GCCATTTTGATTCATTACTTAGG - Intergenic
1045418312 8:101988991-101989013 CTCCTTTTCAATCCTGACTCAGG - Intronic
1045983265 8:108217623-108217645 CTCATTTGGATTCCTGAAACTGG - Intronic
1046707874 8:117476490-117476512 CTGATTTTGATTTATGATCCTGG + Intergenic
1052589954 9:30479258-30479280 CTCATTTTTATGTATGACACAGG - Intergenic
1053093740 9:35305861-35305883 CTCTTTTTGGTTGATAACTCTGG - Intronic
1054953567 9:70882216-70882238 CTCATTTTGTTACATGCCTATGG + Intronic
1055598618 9:77891926-77891948 CTCATCTTGTTTCATGCCTGGGG - Intronic
1055821596 9:80271356-80271378 ATCATTGGGATTCATGACTATGG - Intergenic
1057743858 9:97735955-97735977 TTCCTTTTGAATCATGAATCAGG - Intergenic
1061957626 9:133971781-133971803 CCCATTGTGATTCAGGACCCGGG - Intronic
1061976692 9:134071839-134071861 CACATTTGGGTTCATGGCTCAGG - Intergenic
1191999242 X:67130423-67130445 CTTATATTAATTCCTGACTCAGG + Intergenic
1193266691 X:79480438-79480460 CTCATTTTGATACCAGTCTCTGG - Intergenic
1194528686 X:95015501-95015523 TTCATTTTGAATCCTGGCTCTGG + Intergenic
1197516442 X:127436050-127436072 CTCATCTGTATACATGACTCTGG + Intergenic
1197812123 X:130454295-130454317 CTCATCTTGATTTATGTCACTGG + Intergenic
1201503158 Y:14668007-14668029 GTCATTTTGATAGATGACTCTGG + Intronic