ID: 1118583170

View in Genome Browser
Species Human (GRCh38)
Location 14:67325242-67325264
Sequence GAGGGTGAAGAGGAAGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 6375
Summary {0: 1, 1: 5, 2: 113, 3: 1012, 4: 5244}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118583170 Original CRISPR GAGGGTGAAGAGGAAGAGGA AGG (reversed) Intronic
Too many off-targets to display for this crispr