ID: 1118589527

View in Genome Browser
Species Human (GRCh38)
Location 14:67391046-67391068
Sequence GGAGGCAGCAGGTGTCAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 420
Summary {0: 1, 1: 0, 2: 6, 3: 40, 4: 373}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118589517_1118589527 28 Left 1118589517 14:67390995-67391017 CCATGCAGAAGGAAAGGGGACAC 0: 1
1: 0
2: 0
3: 25
4: 198
Right 1118589527 14:67391046-67391068 GGAGGCAGCAGGTGTCAGCTGGG 0: 1
1: 0
2: 6
3: 40
4: 373

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118589527 Original CRISPR GGAGGCAGCAGGTGTCAGCT GGG Intronic
900009316 1:91429-91451 GGTGGCAGCAGAGGTCAGCAAGG + Intergenic
900025432 1:268008-268030 GGTGGCAGCAGAGGTCAGCAAGG + Intergenic
900029035 1:357390-357412 GGTGGCAGCAGAGGTCAGCAAGG + Intergenic
900049637 1:586162-586184 GGTGGCAGCAGAGGTCAGCAAGG + Intergenic
900371521 1:2334238-2334260 GGGGGCAGCAGGTGTAAGAACGG + Intronic
901050992 1:6425795-6425817 GGAGGCAGCAAGAATCAGCCTGG - Intronic
901165785 1:7220767-7220789 GGGGACAGCAGGTGCCACCTGGG - Intronic
901880835 1:12192816-12192838 GGAGGCAGCAGGGGACAGAGTGG - Intronic
902651379 1:17839848-17839870 AGACACAGCAGGTGCCAGCTGGG + Intergenic
902745486 1:18470942-18470964 GGAGCCAGCAAGTGGCAGATCGG + Intergenic
903144454 1:21361720-21361742 GAAAGGAGCAGGTCTCAGCTTGG + Intergenic
903179451 1:21597946-21597968 GGAGGCTGCACGTACCAGCTGGG + Exonic
903578259 1:24352546-24352568 GGTGTGAGCAGGTGTGAGCTTGG + Intronic
903656252 1:24950403-24950425 GGAGGCAGCAGGAGGCAGACTGG + Intronic
903680749 1:25095142-25095164 GGAGGCGCGAGGAGTCAGCTAGG + Intergenic
903847053 1:26284933-26284955 GGAGGGAGCATGTGTCACCAGGG - Intronic
904201064 1:28819299-28819321 GGAGGCAGCAGGAGGAGGCTGGG + Intronic
905167557 1:36091926-36091948 GGAGGAGGCGTGTGTCAGCTGGG - Exonic
906120819 1:43389508-43389530 GGAGGCAGCACCTGTTTGCTTGG - Intronic
908101620 1:60796943-60796965 GAAGGCAGCAAATGTGAGCTAGG + Intergenic
912151849 1:106869066-106869088 GGTGGCATCAGATGTCAACTGGG - Intergenic
912921532 1:113872059-113872081 GGAAACAGAAGGTGTCAACTTGG - Intergenic
914919205 1:151836336-151836358 GGAGGCAGCAGCTGGCAGTGGGG + Intergenic
916051947 1:161042516-161042538 GGTGGCTGCAGGTGTTATCTGGG - Intronic
919799503 1:201344923-201344945 GGAGGCAGGAGGGGTGGGCTGGG - Intergenic
922096410 1:222446649-222446671 GGAGGCTGCAGGTGGCACCAGGG - Intergenic
922207479 1:223461221-223461243 GGAGGAAGCAGGGGTCTGCTGGG - Intergenic
922791600 1:228314175-228314197 GGAGGAAGCAGGTGACAGCAGGG - Intronic
922802545 1:228370987-228371009 GGGGGCAGCAGGCATCAGGTGGG - Intronic
923063366 1:230497126-230497148 GCTGGCAGCAGGTGTCAGCGGGG - Intergenic
923327697 1:232895500-232895522 GGAGTCACCAGGTGTCAGAAAGG + Intergenic
924518984 1:244789260-244789282 GTAGGCAGCAGGTCTCATCCCGG - Intergenic
1064119338 10:12605642-12605664 GGAGTGAGCAGGTGACAGTTGGG + Intronic
1065773777 10:29101189-29101211 GGAGGGGGCAGGTGTCCCCTGGG + Intergenic
1065867782 10:29928626-29928648 GGAAGCGGCATGTGTTAGCTTGG - Intergenic
1067036223 10:42920388-42920410 GGAGGCAGTAGATGTGACCTAGG + Intergenic
1067690109 10:48496536-48496558 GGAGGCAGCAGCTCTGGGCTGGG - Intronic
1067715873 10:48690987-48691009 GAAGGCAGCAGGGGGCAGATAGG - Intronic
1067718806 10:48710828-48710850 AGTGGCAGCTGGTGACAGCTTGG + Intronic
1069834127 10:71297901-71297923 GGAGCCAGCAGGTGTCTGCAAGG - Exonic
1069960132 10:72074692-72074714 GGAGGCAGCAGGAGTCGGGAAGG + Intronic
1070145086 10:73768023-73768045 TGGGGCAGCAGGTGGCAGCAGGG + Intronic
1070340901 10:75497598-75497620 GGAGGGAGCAGGAATTAGCTAGG - Intronic
1070370615 10:75778560-75778582 GGAGGCACCTGTGGTCAGCTTGG + Intronic
1070570436 10:77636893-77636915 GGAGGAAGCTGGGGGCAGCTGGG - Intronic
1070586522 10:77770910-77770932 CGAGGCAGCAGGTACCAGCCAGG - Intergenic
1070905589 10:80070157-80070179 GGTGGCAGCAGCTGTCCTCTAGG - Intergenic
1074687607 10:115974775-115974797 GGAGGCAGCGAGGGTCAGTTTGG - Intergenic
1075576490 10:123581414-123581436 GGAGGGAGCAGGTGTCATCATGG - Intergenic
1075736425 10:124667119-124667141 GGTGACAGCAGGTCTCAGTTTGG - Intronic
1075817035 10:125272278-125272300 ACAGGCAACAGGTGTCAGATGGG - Intergenic
1076387224 10:130065922-130065944 GGAGGCAGCAGGCGTCTCTTAGG + Intergenic
1076681515 10:132174201-132174223 ACAGGCAGCAGGAGGCAGCTTGG - Intronic
1076717569 10:132374248-132374270 GGAGGCTGCAGGGGTCTCCTGGG + Intronic
1077062988 11:625927-625949 GGAGGGTGGAGGTGTCACCTGGG - Intronic
1077073582 11:689504-689526 GTAGGAAACAGTTGTCAGCTGGG - Intronic
1077251923 11:1564530-1564552 GGAGGCAGCAGCTGGAAGCTGGG + Intronic
1077300907 11:1846513-1846535 GGAGGCAGGAGGTGCCAGCTGGG - Intergenic
1077385061 11:2265430-2265452 GGGGGCAGCAGGGCTCTGCTAGG - Intergenic
1077419092 11:2441242-2441264 GGAGAGAGCAGGTGGCAGCTGGG + Intergenic
1077539121 11:3138409-3138431 GGTGGCAGCAGGGGTCAGCCGGG + Intronic
1077718224 11:4601999-4602021 GGAAACAGCAGGTATTAGCTGGG + Intronic
1078169044 11:8914598-8914620 GGAGGCAGCAGGTGGCAGCACGG + Intronic
1078404443 11:11057658-11057680 GGAGGAAGCTGTTGTCTGCTGGG + Intergenic
1079143266 11:17828428-17828450 GGATCCAGCTGGAGTCAGCTGGG + Intronic
1079149973 11:17889343-17889365 GGAGGCACCTGATGTCAGTTTGG - Intronic
1079238056 11:18703452-18703474 GGAAGCAGCAGGTCTCAAGTGGG - Exonic
1081261705 11:40970089-40970111 AGAGTCAGCAGGGGTCAGCTGGG - Intronic
1081581072 11:44352388-44352410 TGAGGCAGCAGGAGGCAGCTGGG + Intergenic
1082276159 11:50223752-50223774 TGAGGCAGCAAGAGTCAGCTTGG - Intergenic
1083059742 11:59857461-59857483 GGAGGCTGGAGGTGTAAGCACGG - Intronic
1083367273 11:62148798-62148820 GGAGGCAGCAGGGGCCAGCAAGG + Exonic
1083619869 11:64043543-64043565 GGAGGCAGCAGGTGTGGGAAGGG + Intronic
1083636924 11:64125823-64125845 CAAGGCAGCAGGTGTCGCCTGGG - Intronic
1084376871 11:68783612-68783634 GAACGCAGCAGCTCTCAGCTGGG + Intronic
1084495855 11:69502659-69502681 CCAGGAAGCAGGTGCCAGCTGGG - Intergenic
1084899023 11:72295767-72295789 GGAGGAAGCAGCTGGCTGCTGGG - Intronic
1084944244 11:72630392-72630414 GGAGGGAGCAGGAGTGAGCTTGG + Intronic
1084954792 11:72685472-72685494 GGAGGCAGCAGGGGTCAGCCTGG - Exonic
1085549975 11:77360076-77360098 GGAGGCTCCAGGTGTCAGGCAGG - Intronic
1086439251 11:86812119-86812141 TGGGGCAGCAGGTGTAAGCCAGG + Intronic
1086497823 11:87422251-87422273 GGAGGACGCAGGTGCCAGGTTGG - Intergenic
1087973898 11:104519878-104519900 GGAGGAAACAGATCTCAGCTAGG + Intergenic
1088701650 11:112418385-112418407 GCAGGCAGAAGCTGTCACCTAGG + Intergenic
1088732840 11:112698488-112698510 GGAGGCAGCAAGTGTGGGGTGGG - Intergenic
1089452840 11:118609495-118609517 GGGGGCTGCATGTGTGAGCTGGG - Intronic
1089509124 11:118984808-118984830 TGAGGCTGCAGGTCCCAGCTGGG + Intergenic
1089613969 11:119684930-119684952 GGAGGCAGGAGGGGGCAGCCTGG - Intronic
1089617862 11:119705226-119705248 GGAGGCAGCAGCTGTCCATTAGG + Intronic
1090131035 11:124142220-124142242 GGTGGCAGCAGGGCTCTGCTGGG - Intronic
1091898098 12:4120693-4120715 GGCAGCAGCAGCTGTCTGCTGGG - Intergenic
1092023198 12:5219405-5219427 GGAGGCAGCAAGTGTATGCAGGG - Intergenic
1092782786 12:12002848-12002870 GGAGTCTCCAGGTGTCTGCTGGG + Intergenic
1093551738 12:20420604-20420626 GGAGGCTCCAGGTGACAGCTTGG + Intronic
1093811985 12:23502709-23502731 GGAGGCTTCAGGTATCATCTTGG - Intergenic
1095366947 12:41418829-41418851 GTAGGGTGTAGGTGTCAGCTGGG + Intronic
1096462722 12:51831321-51831343 GGGGACAGCAGGTCCCAGCTCGG + Intergenic
1096519981 12:52179523-52179545 GGAGGCCCCAGCTGGCAGCTGGG + Intronic
1096584222 12:52609092-52609114 GGAGGCCGCAGGTCTCAGCAAGG + Intronic
1096633567 12:52944907-52944929 GGAGGATGCGGGTGGCAGCTGGG - Intronic
1097776936 12:63658100-63658122 GGAGGCTTCAGGTGTCAATTTGG - Intronic
1099204266 12:79710768-79710790 GGAGGCACCAAGAGTCAGCGAGG - Intergenic
1099239281 12:80119133-80119155 GGATTCAGTAGCTGTCAGCTGGG - Intergenic
1100831958 12:98524498-98524520 GGAGGCAGAAGGTTGCAGCAAGG + Intronic
1102008068 12:109601400-109601422 GCGGGCAGCAGGGGTGAGCTGGG - Intergenic
1102228691 12:111247601-111247623 GGGGGCAGCAGGTGTCACTGGGG + Intronic
1103412112 12:120719746-120719768 GGAGGCAGCCCTTGACAGCTGGG - Intronic
1105615620 13:22009536-22009558 GGAGGCTGCAGGTCTGAGGTCGG + Intergenic
1107282356 13:38751294-38751316 GGAGACAGCAGGTGTTGGCAAGG - Intronic
1110654814 13:77985454-77985476 GGAGGCTGGAGGTGAGAGCTGGG - Intergenic
1112229864 13:97578684-97578706 AGAAGCAGCAGGTGGCAGATTGG - Intergenic
1113158763 13:107355042-107355064 GGAGGCTGCAGGGGGCATCTGGG + Intronic
1113708899 13:112451658-112451680 GGAGGCAGAAGGTGGGAGGTGGG + Intergenic
1114527811 14:23377370-23377392 GGAGGCAGCTGTTACCAGCTCGG - Exonic
1114658374 14:24329544-24329566 GGAGGCAGTAGGGGTCAGCAGGG + Intronic
1115503286 14:34068212-34068234 TGAGGCAGCTCGTGTCAGCCAGG - Intronic
1117374429 14:55107956-55107978 CGAGGCTGCAGGCGTGAGCTGGG + Intergenic
1118589527 14:67391046-67391068 GGAGGCAGCAGGTGTCAGCTGGG + Intronic
1119640112 14:76308584-76308606 GGGGGCAGCAGGGGTCTGCTGGG - Intergenic
1119646768 14:76354052-76354074 GGAGGCAGCAGGACCCAGCGGGG - Intronic
1119677180 14:76564630-76564652 GGAGTCTTCAGGGGTCAGCTAGG - Intergenic
1119719958 14:76883845-76883867 GGAGGCTGCAGGTCTGAGGTGGG + Intergenic
1120070864 14:80100739-80100761 GCAGGCAGCAGTTGCTAGCTAGG + Intergenic
1122614003 14:103004331-103004353 GGAGTCAGGAGGTGCCAGGTGGG - Intronic
1124021955 15:25933423-25933445 GGTGGCAGGAGCTGTCAGTTAGG - Intergenic
1124086619 15:26556903-26556925 GGAGCCAGCAGCTGTCAGTCAGG + Intronic
1124373882 15:29118490-29118512 CTGGGCACCAGGTGTCAGCTGGG + Intergenic
1124391515 15:29262900-29262922 GGAAGCAGCAGATACCAGCTGGG - Intronic
1125166748 15:36714908-36714930 TGAGGGAACAGGTGTCAGATGGG + Intronic
1125519652 15:40340710-40340732 GGGGGCAGCTGGGGACAGCTGGG - Intronic
1125531469 15:40416262-40416284 GGAGGAAGCTGGGGTCAGCAGGG - Intronic
1126268300 15:46781009-46781031 GGAGGGAGCAGGAGAAAGCTGGG - Intergenic
1129034225 15:72639998-72640020 GGAGGTAGCAGGTGGGGGCTGGG - Intergenic
1129215657 15:74097218-74097240 GGAGGTAGCAGGTGGGGGCTGGG + Intergenic
1129997953 15:80023095-80023117 GGTGGCAGCAGAGGTAAGCTCGG + Intergenic
1130253551 15:82315589-82315611 GGCAGAAGCAGGTGCCAGCTGGG + Intergenic
1130547775 15:84869163-84869185 GCAGGCAGCAGGCTGCAGCTGGG - Exonic
1130578434 15:85114199-85114221 GCAGGCAGCAGGTGGGTGCTTGG - Intronic
1131157789 15:90085437-90085459 GAGGGCAGCAGGGCTCAGCTGGG - Intronic
1131799711 15:96056514-96056536 GGAGACAGCAAGTGTAAACTGGG - Intergenic
1132270549 15:100520284-100520306 GGAGGCACCAGCCCTCAGCTGGG - Intronic
1132350147 15:101134252-101134274 GGAGGCTGCAGGTGAGAGCCGGG - Intergenic
1132518928 16:378583-378605 GGACCCAGCAGGTGTCAGGAAGG + Intronic
1132841973 16:1982497-1982519 TGGGGCAGGAGCTGTCAGCTGGG - Exonic
1132871441 16:2117384-2117406 GGAGGAAGGAGGTGGGAGCTGGG - Intronic
1132939366 16:2499291-2499313 GGAGGCTGCAGGAGGCGGCTGGG + Intronic
1133214794 16:4285352-4285374 GGAGGCAGCAGGCATGCGCTGGG + Intergenic
1133826128 16:9279915-9279937 GGAGGAAGCTGGTATGAGCTGGG + Intergenic
1134038647 16:11051135-11051157 GGAGGAAGCAGGTGGCAGACGGG + Intronic
1134291326 16:12904221-12904243 TGAGGCAGCGGGTGTCGCCTTGG + Intronic
1135761250 16:25139900-25139922 TGAGCTAGCAGGTGGCAGCTGGG - Intronic
1136562775 16:31050425-31050447 GGAGGCTGCATCTATCAGCTGGG - Intergenic
1137744773 16:50812576-50812598 TGAGGCAGGAGGTGGCAGGTTGG - Intergenic
1138560653 16:57799058-57799080 GGAGGCGGCAGGTGCGAGCCAGG + Intronic
1138776509 16:59729847-59729869 GAAGGCAGGAGGGGTCTGCTGGG - Intronic
1140031733 16:71344659-71344681 AGAGGCAGCAGGTGTGAGCTGGG + Intergenic
1140134685 16:72195491-72195513 GGAGGCAGGAGGGGTTAGCAAGG - Intergenic
1140623869 16:76769319-76769341 AGAGTGAACAGGTGTCAGCTGGG + Intergenic
1141377057 16:83541113-83541135 AGAGGCTGGAGGTGGCAGCTGGG - Intronic
1141503194 16:84458864-84458886 GGAGGCATCAGGTGTACCCTTGG + Intronic
1142127554 16:88417659-88417681 GGAGGCAGCTGGCGTTTGCTGGG + Intergenic
1142409189 16:89907700-89907722 GGAGGCGGGAGGTGGCAGGTGGG - Intronic
1142409305 16:89908027-89908049 GGAGGTAGGAGGTGGGAGCTGGG - Intronic
1142409510 16:89908678-89908700 GGAGGCGGGAGGTGGGAGCTGGG - Intronic
1142409529 16:89908727-89908749 GGAGGCAGGAGCTGGGAGCTGGG - Intronic
1142455007 16:90215470-90215492 GGTGGCAGCAGAGGTCAGCAAGG - Intergenic
1142741725 17:1935459-1935481 GGAGGCAGCAAGAGTCACTTTGG - Exonic
1142867229 17:2798377-2798399 GCACACAGCAGGTGTCTGCTTGG + Intronic
1143016573 17:3893756-3893778 GGAGGCAGCAGGTGACTCCCAGG - Intronic
1143125643 17:4639683-4639705 GGAGGGAGCAGGGCTCAGCCGGG - Intronic
1143181260 17:4985908-4985930 GGAGGCAGCAGCGGGCAGCGAGG + Exonic
1143302328 17:5919759-5919781 AATGGCAGCAGGTGTGAGCTGGG + Intronic
1143402834 17:6657140-6657162 GGAGGGAGCAGGGCTCAGCCGGG + Intergenic
1143608136 17:8002791-8002813 GGAGGCGTCAGGGGTCAGCAGGG - Intronic
1144338666 17:14295705-14295727 GGAGGAAGCAGGTGTGGGCAGGG + Intergenic
1144705127 17:17363164-17363186 GGTGGGAGCAGGAGCCAGCTAGG - Intergenic
1144764923 17:17727447-17727469 GGCGGCACCAGGGGTAAGCTTGG - Intronic
1144946471 17:18971979-18972001 GGAGGCTGCGGGGGTGAGCTGGG - Intronic
1145110656 17:20158469-20158491 GGAGGCAGCAGGTTTGGGCAGGG + Intronic
1146005389 17:29157430-29157452 GGAGTCAGAAGGTCTGAGCTAGG + Intronic
1146321747 17:31852203-31852225 GGAGGCGGATGGTGCCAGCTGGG + Exonic
1147632342 17:41940206-41940228 GGAAGCAGCAGGACTCAGGTCGG - Intronic
1148693510 17:49546029-49546051 GGGGGCGGCAGCTGTCTGCTCGG + Intergenic
1149561186 17:57609019-57609041 TGAGGCAGGAGGGGTGAGCTTGG - Intronic
1150923049 17:69503924-69503946 GGAAGAACCAGATGTCAGCTGGG + Intronic
1151685845 17:75646215-75646237 GGAGGCACCAGGCGCCAGCCAGG + Intronic
1151732646 17:75920477-75920499 GGAGGTAGCTGATCTCAGCTGGG - Intronic
1151815495 17:76469570-76469592 GCAGGGAGCAGGTGTCCCCTGGG - Intronic
1151963448 17:77419397-77419419 GGAAGCGGGAGGGGTCAGCTGGG - Intronic
1151967785 17:77440596-77440618 GAAGGGAGCAGCTGTCCGCTTGG - Intronic
1152023943 17:77796744-77796766 GGGGGCAGCTGGGGACAGCTGGG + Intergenic
1152725337 17:81942222-81942244 GGAGGCAGGAGGCGGCAGCCTGG + Intronic
1152950723 17:83229166-83229188 GGTGGCAGCAGAGGTCAGCAAGG - Intergenic
1153770584 18:8412418-8412440 GGAGGCAGCAGCTGTAGCCTAGG + Intergenic
1155592044 18:27438517-27438539 GGAGGCAGAAGGTGGGAGGTTGG + Intergenic
1156499840 18:37550727-37550749 GGAGGCAGCAGAGGTCTGCCCGG - Intronic
1157403849 18:47407630-47407652 GGAGGCAGGAGGTCTCTGCTAGG - Intergenic
1157471577 18:47992934-47992956 AGTGGCAGCAGGTCTCAGATGGG - Intergenic
1157858449 18:51121426-51121448 GGAGGCACCAAGTGTGAGCGAGG + Intergenic
1159090892 18:63847800-63847822 GGAGGAAGCAGTTGTCAGAGAGG - Intergenic
1160844211 19:1159503-1159525 GGGGGCAGCAGGGGACAGTTGGG + Intronic
1160962033 19:1726296-1726318 GGAGGGTGCAGATGTCAGCACGG - Intergenic
1161060755 19:2213658-2213680 GCAGGTGGCAGGTGGCAGCTGGG + Intronic
1161152542 19:2717157-2717179 GGAGGCAGCGGGGGTCAGTGGGG + Exonic
1161200031 19:3009503-3009525 GGGCGCAGGAGGTGTCAGCAGGG - Intronic
1162398545 19:10431609-10431631 GGAGGCAGAAGTTGGCAGCCCGG + Intronic
1162473957 19:10888714-10888736 AGAGACAGCAGATGTGAGCTGGG - Intronic
1163005272 19:14393500-14393522 GGAGCCAGCAGTGGGCAGCTGGG + Intronic
1163691202 19:18739385-18739407 GGAGGCCTCAGGCGGCAGCTTGG - Intronic
1163715766 19:18871040-18871062 GGAGACAGCAGATGCCAGCCAGG - Intronic
1164051742 19:21589775-21589797 GGTGGCACCAGGTGTGTGCTGGG - Intergenic
1166111464 19:40625826-40625848 GGAGACAGCATGTGTCAGAGTGG - Intronic
1166221335 19:41366603-41366625 TGAGGCAGGAGGTGCCAGCCAGG - Intronic
1166946703 19:46401636-46401658 TGTGGCAGCGGGTGGCAGCTGGG + Intergenic
1166979993 19:46626519-46626541 GGAAGCTGCGGGTGCCAGCTGGG - Intergenic
1167097483 19:47382097-47382119 GGAAGCAGCACGTGTGAGCTGGG + Exonic
1167104257 19:47421023-47421045 GGAGGGAGCAGGTGGCGGCCAGG + Intergenic
1167135625 19:47613561-47613583 GCAGGCAGCAGTTGTCATCGTGG - Intronic
1167399338 19:49254626-49254648 GGAGGTTGCAGGACTCAGCTGGG + Intergenic
1167497598 19:49828681-49828703 GGAGGCTGCAGGTGTGTCCTTGG + Intronic
1168031494 19:53683259-53683281 GGATGGAGCAGGTGTCTTCTGGG + Intergenic
1168687822 19:58358915-58358937 GGCTACAGCAGGAGTCAGCTGGG - Intronic
925157206 2:1657419-1657441 GGAGGCGGCAGGTTTCAGTTAGG - Intronic
926246395 2:11124647-11124669 GGAGGCAGCAGGGGGCACCCTGG - Intergenic
926326011 2:11785598-11785620 GCAGTCAGCAGTTATCAGCTGGG + Intronic
926393342 2:12416753-12416775 GGTGCCAGCAGGGGGCAGCTTGG + Intergenic
926635216 2:15171212-15171234 GGAGGAAGGAGGAATCAGCTTGG - Intronic
927466117 2:23337862-23337884 GGAGCAAGAAGGTGTCATCTTGG + Intergenic
928735354 2:34282475-34282497 GGTGGCATCAGGTGTCATCCTGG - Intergenic
929246157 2:39705900-39705922 GGGGGCAGCAGATGTATGCTTGG + Intronic
929533078 2:42764349-42764371 GGAGGAAGCAGGGCTCAGCAGGG + Intergenic
929825286 2:45305286-45305308 GTAGGCAGCAGGTGGGAGCCTGG - Intergenic
930028472 2:47044100-47044122 TGAAGCAGCAGGTGTCAGTGAGG - Intronic
932375973 2:71236068-71236090 GGAGGCACCAGGTTTTGGCTTGG - Intergenic
932448242 2:71793786-71793808 GGAGGAAGCAGGGGTCAGAGAGG - Intergenic
933709728 2:85316226-85316248 GGAGGCTGCAGGGGACAGCAGGG - Intergenic
933713334 2:85343537-85343559 GGAGGCTGCAGGGGACAGCAGGG + Intronic
935717539 2:105952393-105952415 GCATCCAGCAGGTGTCTGCTGGG - Intergenic
935943666 2:108267653-108267675 GGATGCAGGGGGTGTCAGCCTGG - Intergenic
936638130 2:114282493-114282515 GGAGGCAGCAGGTAAGAGCAGGG - Intergenic
937086752 2:119177057-119177079 TGAGCCAGCATGTGTCAGGTAGG - Intergenic
937335192 2:121058296-121058318 GCAGGGAGAAGGTGTCTGCTCGG + Intergenic
937463779 2:122111678-122111700 GGATGCAGCAGGTGACAGGGAGG - Intergenic
939038079 2:137156870-137156892 TGTGGCAGCAGCTGTCAGCTGGG + Intronic
940441187 2:153718638-153718660 GGAGGCAGCAGGTGTCAGGACGG + Intergenic
942788269 2:179727861-179727883 GGAGGCAGCAGGTTTTCACTGGG + Intronic
944412477 2:199457877-199457899 AGAGGCTGGAGGTGACAGCTTGG - Exonic
944824721 2:203470536-203470558 GGGATCAGCAGGAGTCAGCTGGG - Intronic
944867159 2:203873820-203873842 GAAGGCAGCAGGTGGCAGAATGG + Exonic
945933620 2:215881118-215881140 ACAAGCAGCAGGTGACAGCTGGG + Intergenic
946033056 2:216720265-216720287 CTAGGCTGCAGGTGTCAGTTAGG + Intergenic
946770601 2:223084965-223084987 GGAGCCAGCAGGGGACAGATGGG - Intronic
947177779 2:227384724-227384746 AGAGGCAGCTGTAGTCAGCTGGG - Intergenic
947739329 2:232477996-232478018 GGTGTCAGCAGGTGTCAGCATGG - Intergenic
947909533 2:233792050-233792072 GGAGACAGCAGGTGAGAGCAAGG - Intronic
948792089 2:240384376-240384398 GTAGCCAGCAGGGGACAGCTGGG - Intergenic
949003585 2:241632655-241632677 GCAGGCAGCACGCGTCAGCCAGG - Intronic
949086477 2:242160136-242160158 GGTGGCAGCAGAGGTCAGCAAGG - Intergenic
1168952872 20:1814551-1814573 GGAGGCAGCATGAGTGAGCATGG - Intergenic
1169305821 20:4489549-4489571 GGGGTCAGCTGGGGTCAGCTAGG + Intergenic
1170704547 20:18733385-18733407 GGAGGCTGCAGGTGACCTCTGGG + Intronic
1171308474 20:24126179-24126201 GGATTCAGCAGGGCTCAGCTGGG + Intergenic
1171383531 20:24751744-24751766 TGATGCAGTAGGTGTGAGCTGGG + Intergenic
1172023748 20:31934285-31934307 GAAGGGAACAGGTGTGAGCTGGG - Intronic
1172026524 20:31952527-31952549 GAAGGAAGCAGGAATCAGCTGGG + Intergenic
1173376125 20:42484895-42484917 GGAAGCAGAATGTGGCAGCTAGG - Intronic
1173667481 20:44773290-44773312 GGAGGCTGCAGATGCAAGCTAGG - Intronic
1174110007 20:48192387-48192409 GGGGTCAGCAGGAGTCAGGTGGG + Intergenic
1175258205 20:57659389-57659411 GGAGGAAGCTGCTGTCAGGTGGG + Intronic
1175284718 20:57830363-57830385 TGGGGCAGCAGGTGTGAGCCAGG - Intergenic
1175286095 20:57837819-57837841 GGATGCAGCAGGTGTTACCCTGG + Intergenic
1175549200 20:59805764-59805786 TGGGACAGCAGGTGTCAGCCGGG + Intronic
1175725639 20:61316534-61316556 GGATGCAGCAGATGGCAGATGGG - Intronic
1175743448 20:61436562-61436584 GGAGTCAGCAGGGGTCAGCAGGG + Intronic
1176051047 20:63119961-63119983 GCTGGCACCAGGGGTCAGCTGGG - Intergenic
1177508344 21:22048759-22048781 GGAGTCAGCAGTTTGCAGCTTGG + Intergenic
1179090921 21:38264937-38264959 GGAGCCAGCAGGGTTCAGCATGG + Intronic
1179239971 21:39581362-39581384 AGAGGCAGCAGGCAGCAGCTAGG - Intronic
1179594565 21:42433801-42433823 GGGGGCAGCAGGGGTCAGCGGGG - Intronic
1179821571 21:43940180-43940202 GCGGGGAGCAGGTGTCAGCCTGG - Intronic
1180869733 22:19139310-19139332 GGTAGCAGCAGGTGTCAGAAGGG + Intronic
1181169069 22:20998225-20998247 GGAGGCAGGAGTTGACAGCATGG - Exonic
1181179093 22:21054795-21054817 ATAGGCATGAGGTGTCAGCTGGG + Intronic
1182889143 22:33802218-33802240 GGAGTCAGCAGCTGTGAGTTGGG - Intronic
1183108035 22:35628650-35628672 GGAGGCAGCAGACGTCACCTGGG + Intronic
1183300388 22:37056277-37056299 GGAGGCAGAAGGAGTGACCTGGG + Intronic
1183788452 22:40045372-40045394 CGCGCCAGCAGGTGTGAGCTGGG + Intronic
1184014619 22:41776604-41776626 GGAGGCAGCAGCAGTCCGCAGGG + Intronic
1184117076 22:42428389-42428411 GGAGGCAGGAGGTCTCAGCCGGG + Intronic
1184218618 22:43084447-43084469 GAAGGAAAAAGGTGTCAGCTGGG - Intronic
1185135427 22:49068907-49068929 CGAGACAGCAGGTGACAGCAGGG - Intergenic
1185157822 22:49204942-49204964 GGAGGCCGCTGGGGTCACCTGGG - Intergenic
949501940 3:4688388-4688410 GGAGTCAGAAGGTGTTTGCTGGG - Intronic
950306117 3:11916204-11916226 GGAGGCACCAGCTTTCAGCTTGG - Intergenic
950497833 3:13344849-13344871 GGAGCCAGCAGGTGGAGGCTGGG - Intronic
950504605 3:13386879-13386901 GGAGGCAGGAGGTCACAGGTCGG - Intronic
951720203 3:25689711-25689733 GGAGGCAGCAGGGGCCAGGTAGG + Intergenic
952265116 3:31777920-31777942 GAAGGCAGCAGGTGGAATCTGGG + Intronic
952740860 3:36733143-36733165 GGTGGGAACAGGTCTCAGCTTGG - Intronic
953578948 3:44136124-44136146 GGAGGAAGCAGGAGTCAGCAGGG - Intergenic
954372440 3:50175947-50175969 GGTGGCAGCAGGTGGCAGGATGG - Intronic
954373505 3:50182619-50182641 GCAGGTGGCAGGGGTCAGCTGGG - Intronic
955070325 3:55567542-55567564 GGTGGAAGCAGGACTCAGCTGGG + Intronic
956472627 3:69583995-69584017 GGAGGTAGCAGGTGTCAGACAGG + Intergenic
958504438 3:94956231-94956253 GGAAGCAGCAAGTGTCAGCGAGG - Intergenic
960934728 3:122891279-122891301 AGAGGCATCAAGTGTCACCTGGG - Intergenic
961043514 3:123693640-123693662 TGGGGAAGGAGGTGTCAGCTAGG + Intronic
961082138 3:124035413-124035435 GGAGGCAAGGGGGGTCAGCTGGG - Intergenic
963068019 3:141279249-141279271 GGAGGCAGCAGGGGCCACCGTGG - Intronic
963253359 3:143121104-143121126 GGGGGCAGCCGGAGGCAGCTGGG + Exonic
963772406 3:149401346-149401368 GAAGGGAGCAGGTGGCAGCGTGG + Intergenic
964475156 3:157091343-157091365 GGAAGCAGGAGGGGTCAGCAAGG + Intergenic
967876974 3:194274060-194274082 AGAAGCAGCAGGTATCAGATTGG - Intergenic
968263084 3:197340507-197340529 GGAGGCAGATGGTGTAAGCTGGG + Intergenic
968453452 4:685922-685944 GGATGCACAAAGTGTCAGCTCGG + Intronic
968612708 4:1564401-1564423 GGAGGAAGGAGACGTCAGCTAGG + Intergenic
968823194 4:2872147-2872169 GGAGGAAGCAGATGTCACTTGGG + Intronic
969114542 4:4862962-4862984 GAAGGCAGCCGGTGGCAGCATGG - Exonic
969500065 4:7547281-7547303 GGAGGCTGCTGGAGTCAGCTTGG - Intronic
969530798 4:7729193-7729215 GGAGGCAGCTGGAGTCAGTGGGG + Intronic
969709283 4:8833446-8833468 GGTGTCTGCAAGTGTCAGCTTGG + Intergenic
975238729 4:72031922-72031944 GGAGGCACCAGCTGGCCGCTGGG - Exonic
976777376 4:88721217-88721239 GTCGGCAGCAGGTGCCAACTAGG + Intergenic
977564287 4:98566077-98566099 GGAGGCAACAGCTGTCCGCCAGG + Intronic
979107446 4:116705712-116705734 GGACGCAGCAGGAGTCTGCGCGG - Intergenic
980164996 4:129215194-129215216 GCAGGTAGGAGGGGTCAGCTGGG - Intergenic
980420127 4:132547950-132547972 GGAGGCAGGAGGTGAAGGCTGGG + Intergenic
981199261 4:141960052-141960074 GGAGCAAGCAGGTGTTAGCTGGG + Intergenic
983010132 4:162537134-162537156 GGAGCCAGGAGAGGTCAGCTAGG + Intergenic
983527308 4:168772198-168772220 AGAGGGAGCAAGTGACAGCTAGG + Intronic
984257245 4:177403511-177403533 GTAGGCAGAAAGTGACAGCTGGG - Intergenic
984735407 4:183103225-183103247 GGAGGAAGGGGGTGCCAGCTGGG + Intronic
984952357 4:185017074-185017096 CGAGGCAGCAAGTGTGAGCGAGG + Intergenic
985359896 4:189162387-189162409 GGGGGCAGCAGGAGTGAGGTTGG + Intergenic
988511431 5:31867870-31867892 GAAGGCAGCAGGTGTGGGGTGGG + Intronic
990801360 5:59607648-59607670 GGAGGCAGCAGGGGGTAGGTGGG + Intronic
990865201 5:60372475-60372497 GGGGGAAGCAGGTGTCAGACTGG - Intronic
992472746 5:77074692-77074714 GAAGGAAACAGGTGTCAGCTGGG + Exonic
992552084 5:77868550-77868572 GGAGGCAGCACGGTTCTGCTCGG + Intronic
993848183 5:92971993-92972015 GGAAGCAGGAGGCTTCAGCTGGG + Intergenic
997061641 5:130512021-130512043 GGAGGCAGACTGTGTCAGTTTGG - Intergenic
998870074 5:146543075-146543097 GGAGTCAGTTGTTGTCAGCTGGG + Intergenic
999177332 5:149640558-149640580 GGAGGCAGCAGGTGTCCATCAGG + Intergenic
999759592 5:154690287-154690309 GGAAGCAGCAGGTTTCATGTAGG + Intergenic
1000185946 5:158858307-158858329 GAAGGCAGCATGTGTCAGGCGGG - Intronic
1000277952 5:159755755-159755777 CAAGGCAGCAGGTGACACCTGGG + Intergenic
1001036572 5:168300867-168300889 GCAGGCATCAGGTGGCTGCTAGG + Intronic
1001548592 5:172586340-172586362 CGAGGTGGGAGGTGTCAGCTGGG + Intergenic
1001950679 5:175814523-175814545 AGAGGCAGCCCGTGTCAGCCTGG + Intronic
1002105996 5:176879659-176879681 GGGGGCAGGAGGTGTCGGCTGGG + Intronic
1002181125 5:177431621-177431643 GCAGGCAGCAGGTGTGGGCCTGG + Intronic
1002608664 5:180399403-180399425 GGAGGCCGGAAGTGTCACCTGGG + Intergenic
1002744955 5:181462981-181463003 GGTGGCAGCAGAGGTCAGCAAGG - Intergenic
1002801730 6:529376-529398 GGAGGCAGCAGGTCTGAGAGAGG + Intronic
1002901795 6:1416153-1416175 GGAGGCAGCCGTGGTCAGCAGGG + Intergenic
1004189887 6:13454763-13454785 ACAGACAGCAGGTGGCAGCTGGG + Intronic
1005991084 6:30902588-30902610 GGAGGCAGCATGTGCCAGGAGGG - Intergenic
1006318332 6:33304285-33304307 GGAGGTAGCAGGTAAGAGCTGGG - Exonic
1006620813 6:35362696-35362718 GTAGGCAGCAGGTGACTGCAGGG + Intronic
1007473918 6:42106887-42106909 GGAGGCAGTGGGAGTCGGCTGGG + Exonic
1007737289 6:43989756-43989778 GGAGGCAGCAGGTGGCTGGCTGG + Intergenic
1009437890 6:63638257-63638279 GGAGGCAGCAAGTGGCAATTTGG + Intronic
1013713385 6:112928245-112928267 CCAGACAGCTGGTGTCAGCTTGG - Intergenic
1017129011 6:151092103-151092125 GGGGGCAGCAGGTGTGGGCAGGG - Intronic
1018155433 6:160981076-160981098 GGAGGAAGCAGCTTTCACCTTGG + Intergenic
1019249866 6:170736522-170736544 GGTGGCAGCAGAGGTCAGCAAGG - Intergenic
1019415506 7:924940-924962 GGAGACAGCAGCTGGCACCTGGG + Intronic
1019511523 7:1419920-1419942 GGAGGGAGCTGGTGGCAGCCAGG - Intergenic
1019602673 7:1893136-1893158 AGAGGCAGCAGGTTCCCGCTGGG + Intronic
1020617477 7:10477044-10477066 GGTGGCAGCAGGTAGCAGGTAGG + Intergenic
1021840666 7:24719306-24719328 GGAGTGAGCAGGTGACAGCCAGG + Intronic
1022361487 7:29663674-29663696 GGAGGCTTCAGGTGTCAGTTTGG + Intergenic
1022935853 7:35175761-35175783 GGAGGCTTCAGGTGTCAATTTGG - Intergenic
1024082351 7:45865807-45865829 GGCAGCAGCAGGTGTCAGAAAGG + Intergenic
1024959581 7:54960255-54960277 GGAGGCTGGAGGTGTCATATAGG - Intergenic
1025182191 7:56828854-56828876 TGAGGCAGGAGGTGACAGTTGGG + Intergenic
1029443251 7:100599863-100599885 GGGGGCTGCAGGGGTCAGCAGGG + Intronic
1033155213 7:138950963-138950985 GGAGGTAACTGGTGACAGCTGGG - Intronic
1034102061 7:148458470-148458492 GAAGCCAGCAGGTGTCAGCAGGG - Intergenic
1035353648 7:158264549-158264571 GGTGGCAGCAGGTGACAGTGGGG + Intronic
1035498232 8:71133-71155 GGTGGCAGCAGAGGTCAGCAAGG + Intergenic
1037741658 8:21613436-21613458 GGGGGCTACAGGTGTGAGCTTGG + Intergenic
1038820806 8:30950310-30950332 GGAAGCAGCAGGTGTCTAATAGG - Intergenic
1039764481 8:40613588-40613610 GTAGGGAGCATGTGTGAGCTGGG - Intronic
1039792647 8:40887957-40887979 GGAGGCAGGAGGGGTGTGCTGGG - Intronic
1040777128 8:51058296-51058318 GGAAGTAGCGGCTGTCAGCTGGG - Intergenic
1045024212 8:98071127-98071149 GGTGGCAGCTGGTGGTAGCTAGG + Intronic
1045471875 8:102519945-102519967 GGAGGCAGGATCTGTGAGCTTGG + Intergenic
1047435826 8:124834822-124834844 GGCGGCAGCATGTGACACCTGGG - Intergenic
1047720398 8:127633659-127633681 GGAAGGAGCAGGTGGCATCTGGG - Intergenic
1047723559 8:127665230-127665252 AGAGGCAGGAGATGGCAGCTTGG - Intergenic
1048096045 8:131295659-131295681 GCAGTCAGCAGATGTTAGCTGGG - Intergenic
1048304189 8:133272190-133272212 GTGGGCAGAAGGTGTCAGCCTGG + Intronic
1049113270 8:140663430-140663452 GCAGGCAGCTGGAGTCAGCAGGG + Intronic
1049160575 8:141095275-141095297 GGATCCAGCAGTTCTCAGCTGGG - Intergenic
1049199836 8:141334611-141334633 GGTGGCCGGAGGTGTCAGCCGGG - Intergenic
1049558193 8:143294106-143294128 GGAGGCAGGAGGACTCAGCCAGG - Intronic
1049612018 8:143560265-143560287 GGAAGCTGCAGGGGTCATCTGGG + Intronic
1050077495 9:1880322-1880344 TGAGGGAGAAGGTGTCAACTTGG + Intergenic
1050729804 9:8696105-8696127 AGAGGCAGCAGACCTCAGCTGGG + Intronic
1051184067 9:14440146-14440168 TGAGGCACCTGGTGTGAGCTGGG + Intergenic
1053168492 9:35861407-35861429 GAAGGCAGCAGGTAACAGCAAGG - Intergenic
1054835497 9:69671998-69672020 GGAGGCAGCAGGCGACATCCAGG - Intronic
1055503481 9:76924957-76924979 GGAGGCAGAAGATGTCAGCTGGG + Intergenic
1055785417 9:79864878-79864900 GGAGACAGCAGGTGCAGGCTGGG - Intergenic
1058778780 9:108312169-108312191 GGAGGCAGAATTTGGCAGCTGGG + Intergenic
1060656153 9:125374147-125374169 GGAGGCAGGAGGGGGCACCTGGG - Intergenic
1061456686 9:130703384-130703406 TGGGGCAGGAGGTGTCAGGTGGG + Intronic
1062410584 9:136422174-136422196 GGAGGCAGCAGGTGCATGGTGGG - Intronic
1062444092 9:136586122-136586144 GGAGGCAGCAGCTGTCCCCTGGG - Intergenic
1062479028 9:136742998-136743020 GGAGGCAACAGGTGTGGCCTTGG + Intronic
1203788133 EBV:139274-139296 GTAGGCACCAGGTGTCACCAGGG + Intergenic
1186493420 X:9992904-9992926 GGCGGCAGCAGGGCTCAGCCAGG - Intergenic
1189221084 X:39372644-39372666 GGACTCAGCAGGTCTCAGCTGGG - Intergenic
1190493819 X:51008196-51008218 GGTGACAGCAGGGGTTAGCTGGG + Intergenic
1195063682 X:101220099-101220121 GCAGGCGGCAGCTGTAAGCTGGG - Exonic
1198449047 X:136748095-136748117 GGATGCAGCGGGTGGCAGTTGGG - Intronic
1199679725 X:150216266-150216288 GGAGGCAGCATGAGCCAGTTTGG - Intergenic
1199695506 X:150340783-150340805 GGAGGCAGCATGAGCCAGTTTGG + Intergenic
1199827803 X:151516749-151516771 GGAGGCTGCAGGTGACTGCGTGG + Intergenic