ID: 1118592473

View in Genome Browser
Species Human (GRCh38)
Location 14:67411880-67411902
Sequence GCGGCCCGGTCCCACCATGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 2, 3: 6, 4: 103}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118592467_1118592473 -8 Left 1118592467 14:67411865-67411887 CCATCAGGGCCACAGGCGGCCCG 0: 1
1: 0
2: 0
3: 7
4: 187
Right 1118592473 14:67411880-67411902 GCGGCCCGGTCCCACCATGGGGG 0: 1
1: 0
2: 2
3: 6
4: 103
1118592466_1118592473 -7 Left 1118592466 14:67411864-67411886 CCCATCAGGGCCACAGGCGGCCC 0: 1
1: 0
2: 0
3: 32
4: 175
Right 1118592473 14:67411880-67411902 GCGGCCCGGTCCCACCATGGGGG 0: 1
1: 0
2: 2
3: 6
4: 103
1118592454_1118592473 29 Left 1118592454 14:67411828-67411850 CCGCTTACCCCGCGTCCCCTCGG 0: 1
1: 0
2: 0
3: 7
4: 102
Right 1118592473 14:67411880-67411902 GCGGCCCGGTCCCACCATGGGGG 0: 1
1: 0
2: 2
3: 6
4: 103
1118592458_1118592473 20 Left 1118592458 14:67411837-67411859 CCGCGTCCCCTCGGACATGCAGC 0: 1
1: 0
2: 0
3: 4
4: 95
Right 1118592473 14:67411880-67411902 GCGGCCCGGTCCCACCATGGGGG 0: 1
1: 0
2: 2
3: 6
4: 103
1118592460_1118592473 13 Left 1118592460 14:67411844-67411866 CCCTCGGACATGCAGCTCTGCCC 0: 1
1: 0
2: 1
3: 14
4: 131
Right 1118592473 14:67411880-67411902 GCGGCCCGGTCCCACCATGGGGG 0: 1
1: 0
2: 2
3: 6
4: 103
1118592459_1118592473 14 Left 1118592459 14:67411843-67411865 CCCCTCGGACATGCAGCTCTGCC 0: 1
1: 0
2: 0
3: 9
4: 139
Right 1118592473 14:67411880-67411902 GCGGCCCGGTCCCACCATGGGGG 0: 1
1: 0
2: 2
3: 6
4: 103
1118592461_1118592473 12 Left 1118592461 14:67411845-67411867 CCTCGGACATGCAGCTCTGCCCA 0: 1
1: 0
2: 1
3: 19
4: 178
Right 1118592473 14:67411880-67411902 GCGGCCCGGTCCCACCATGGGGG 0: 1
1: 0
2: 2
3: 6
4: 103
1118592456_1118592473 22 Left 1118592456 14:67411835-67411857 CCCCGCGTCCCCTCGGACATGCA 0: 1
1: 0
2: 0
3: 4
4: 33
Right 1118592473 14:67411880-67411902 GCGGCCCGGTCCCACCATGGGGG 0: 1
1: 0
2: 2
3: 6
4: 103
1118592457_1118592473 21 Left 1118592457 14:67411836-67411858 CCCGCGTCCCCTCGGACATGCAG 0: 1
1: 0
2: 0
3: 9
4: 91
Right 1118592473 14:67411880-67411902 GCGGCCCGGTCCCACCATGGGGG 0: 1
1: 0
2: 2
3: 6
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118592473 Original CRISPR GCGGCCCGGTCCCACCATGG GGG Intronic
902616125 1:17624509-17624531 CAGGCACGGTACCACCATGGAGG - Intronic
904063033 1:27726065-27726087 GCGGCCCGGGCCGGACATGGCGG + Exonic
904108718 1:28107912-28107934 GTGGCCCTTCCCCACCATGGCGG + Intergenic
905086810 1:35387174-35387196 GCTGCCCAGTCCCAGCATGTTGG + Exonic
905490013 1:38336140-38336162 GGGTCACTGTCCCACCATGGGGG - Intergenic
907896799 1:58700046-58700068 GGGGTCAGGTCCCATCATGGCGG - Exonic
908892741 1:68864188-68864210 GTGGGCCGCTCCCAACATGGTGG - Intergenic
916655990 1:166875963-166875985 GAGGCCCGGTCTCTCCAGGGCGG + Intronic
922720966 1:227900134-227900156 GGGGTCTGGTCCCAGCATGGTGG - Intergenic
923504203 1:234591467-234591489 GCTCCCAGGTCCCACCATGAAGG - Intergenic
1062916415 10:1243900-1243922 GCAGTCCCGTCCCACCAGGGAGG - Intronic
1075040743 10:119104688-119104710 GCTGCCCGGTCCCACGATGGGGG - Intronic
1075351251 10:121726824-121726846 GCACCCCGGCCCCACCATCGTGG + Intergenic
1077055437 11:590151-590173 GAACCCCAGTCCCACCATGGGGG + Intronic
1077169388 11:1159508-1159530 GGGGTCTGGTCCCACCATGCTGG + Intronic
1077169420 11:1159615-1159637 GGGGTCTGGTCCCACCATGCTGG + Intronic
1077169452 11:1159729-1159751 GGGGTCTGGTCCCACCATGCTGG + Intronic
1077169465 11:1159776-1159798 GGGGTCTGGTCCCACCATGCTGG + Intronic
1077169525 11:1159992-1160014 GGGGTCTGGTCCCACCATGCTGG + Intronic
1080383365 11:31796491-31796513 GGGGCCAGGGCCCAGCATGGGGG + Intronic
1084448426 11:69217924-69217946 GCTGCCCGGGCTGACCATGGGGG + Intergenic
1084518278 11:69648018-69648040 GCTCCCCGCTGCCACCATGGAGG - Exonic
1085402797 11:76244603-76244625 GGGGCCCTGGCCCATCATGGAGG + Intergenic
1085423094 11:76380703-76380725 GCGGCCCGGGCCCACCTTCGCGG - Intronic
1100492132 12:95090909-95090931 GCGGGGCGGTCTCACCATGTTGG - Intronic
1102351435 12:112195114-112195136 GCGGCCTGGTCCCGGTATGGGGG - Intronic
1105975427 13:25468669-25468691 CCGGCCCGGTCCCTGCAGGGAGG + Intronic
1106120097 13:26852902-26852924 GGGACCTGGTCCCACCCTGGGGG - Intergenic
1106841044 13:33685312-33685334 TCGGCCCATTCCCACCCTGGGGG + Intergenic
1113592227 13:111509055-111509077 GCGGGCCGCTCCCAAGATGGCGG + Intergenic
1117353481 14:54902558-54902580 GCGGCCCGGGCCCAGCAGGCCGG - Exonic
1118592473 14:67411880-67411902 GCGGCCCGGTCCCACCATGGGGG + Intronic
1118910878 14:70061042-70061064 GCAGTCCAGTCCCACCATGGTGG + Intronic
1119863540 14:77954614-77954636 GGGGCCCGGTCCAGGCATGGTGG - Intergenic
1120617635 14:86727414-86727436 GAGGCCCACCCCCACCATGGTGG - Intergenic
1122598030 14:102907144-102907166 ACGGCCTGGTCCCACCCTGAGGG + Exonic
1129606943 15:77029588-77029610 GCTGCCCCGTCCGACCAGGGCGG + Intronic
1130683477 15:86016705-86016727 GCGGCCAGGTTTCACCATGTTGG - Intergenic
1131176441 15:90212232-90212254 GCTGCCCTGTCCCTCCCTGGAGG - Intronic
1131374629 15:91913445-91913467 GAGGCCTGGTCCCACCTGGGAGG - Intronic
1132934684 16:2474542-2474564 GACGCCCTGTCCCCCCATGGGGG - Intergenic
1133097549 16:3457919-3457941 CCTGCCCGCTCCCAACATGGCGG + Intronic
1141420805 16:83914307-83914329 GCTGCCCGGCCACACCACGGCGG - Intronic
1141611293 16:85182438-85182460 GCGGCCTGGTCCCTGCAGGGGGG + Intronic
1141618576 16:85224152-85224174 GAGGCCCTGTCCCACGATGCTGG + Intergenic
1144627580 17:16852179-16852201 GCAGCCGTCTCCCACCATGGGGG + Intergenic
1145047590 17:19630155-19630177 GCTGCCAGGTCCCACCTTAGAGG + Intergenic
1145153375 17:20523851-20523873 GCAGCCATCTCCCACCATGGGGG + Intergenic
1145236927 17:21214681-21214703 GCCGCCCGGGCCCTCCTTGGAGG + Intergenic
1145253638 17:21310735-21310757 AGGGGCCGGCCCCACCATGGGGG - Intronic
1145266644 17:21382921-21382943 GCTGCCCGCTCCCACAGTGGAGG - Intronic
1145322944 17:21777226-21777248 AGGGGCCGGCCCCACCATGGGGG + Intergenic
1146359019 17:32159306-32159328 TCGGCCCGGCCCCATCATGGTGG - Intronic
1149758754 17:59210158-59210180 GCGGACCGGAGCCTCCATGGCGG + Exonic
1150682748 17:67296401-67296423 GCAGGCATGTCCCACCATGGTGG - Intergenic
1152031453 17:77845927-77845949 GAGGCCCAGTCCCACCCAGGGGG - Intergenic
1152738637 17:82009383-82009405 GCAGCCCACTCCCACCCTGGAGG + Intronic
1152900572 17:82938671-82938693 GAGCCCCGGGCCCACCCTGGAGG - Intronic
1153242169 18:3041048-3041070 GCGGGGCGGTCTCACCATGTTGG - Intergenic
1156971550 18:43162992-43163014 GCGGCCCAGTCCCAGCAGGGAGG - Intergenic
1161028170 19:2046171-2046193 GCGGCGCGGGCCCACCTTGACGG + Exonic
1166524973 19:43504920-43504942 CCGGCCCGGCCCCACCCTCGTGG + Exonic
928453404 2:31398594-31398616 TCAGCCCGAGCCCACCATGGAGG - Exonic
930728834 2:54708998-54709020 TCGGCCTGGCCCCACCATGGGGG - Intergenic
932493829 2:72137010-72137032 GCATCCCTGTCCCGCCATGGAGG - Intronic
937990492 2:127659453-127659475 GCGGCCAGGCTCCACCTTGGTGG - Intronic
942501150 2:176592183-176592205 TAGGCCCAGCCCCACCATGGTGG - Intergenic
943720215 2:191196396-191196418 AGGGCTGGGTCCCACCATGGTGG + Intergenic
948122992 2:235544611-235544633 GCTGCACTGTCCCACCTTGGTGG - Intronic
1172056458 20:32157793-32157815 GGTGCCCTTTCCCACCATGGTGG + Exonic
1172947760 20:38702102-38702124 ATGGCCCTGTCCCAGCATGGTGG - Intergenic
1176428807 21:6563992-6564014 GCAGCCCTGGCCCATCATGGGGG + Intergenic
1179704297 21:43172308-43172330 GCAGCCCTGGCCCATCATGGGGG + Exonic
1179827623 21:43975838-43975860 GCGGCCCCGTGCCACCAGGTGGG - Intronic
1180054601 21:45351342-45351364 GCGGCCGGATCCCAGGATGGGGG + Intergenic
1184153003 22:42649309-42649331 GCGGCGCGGGGCCACCATGGGGG - Intronic
1184176531 22:42792431-42792453 TTGGTCCTGTCCCACCATGGAGG + Intergenic
1184663703 22:45976912-45976934 GCATCCCGGGCTCACCATGGTGG - Exonic
1184712804 22:46263064-46263086 GCCGCCCGGTCCCGCCATGGGGG + Exonic
1184923150 22:47619883-47619905 GAGCCCCGGTCCCACGATGTAGG - Intergenic
952408398 3:33025970-33025992 TCGGCCCAGTCCCATCGTGGCGG - Intronic
954445867 3:50546612-50546634 GCGGCCGGGTCCAACCCAGGTGG - Intergenic
955281338 3:57597419-57597441 GCGGCCCGGCCCCTCCAACGCGG + Intronic
956462540 3:69485787-69485809 GCAGCCCAGCCCCATCATGGTGG + Intronic
957888032 3:86316080-86316102 GCCCTCCAGTCCCACCATGGTGG - Intergenic
959431157 3:106256577-106256599 GCGTCCCAGCCCCAGCATGGAGG - Intergenic
961636228 3:128334849-128334871 GCTGCCCTATACCACCATGGTGG - Intronic
962218841 3:133546265-133546287 GCGGCCCGGGCCGGACATGGCGG - Intergenic
963133289 3:141877158-141877180 GCGCCCCGCTCCCAGCAGGGAGG - Intronic
963906788 3:150779496-150779518 CCGGCCCTGGACCACCATGGAGG - Intergenic
967784179 3:193471980-193472002 GCGGGCCACTGCCACCATGGGGG - Intronic
968235380 3:197027952-197027974 CCAGCCCCGGCCCACCATGGAGG + Intronic
968390820 4:191825-191847 GCGGGCCGCTCCCAAGATGGTGG + Intergenic
985662430 5:1163898-1163920 GCAGGCCAGGCCCACCATGGGGG - Intergenic
990545406 5:56816224-56816246 GCGCCCCGGACCCAGCCTGGGGG + Intronic
997359878 5:133288331-133288353 GGCTCCCTGTCCCACCATGGGGG - Intronic
1006191494 6:32212522-32212544 GAGGCCCGGTCCATCCCTGGAGG + Exonic
1007424047 6:41735462-41735484 CCGGCCCCGTGCCACCAGGGAGG + Intronic
1018694979 6:166383546-166383568 CCGGACCGGTCCCTCCAGGGTGG + Intergenic
1026347033 7:69483123-69483145 GCGGACCACTCCCAACATGGCGG - Intergenic
1028417581 7:90596355-90596377 GCGGCGCGGGGCCACCACGGCGG + Intronic
1029698022 7:102227461-102227483 GCAGCCCTGTCCCCCCATCGAGG + Exonic
1030628556 7:111870506-111870528 GAGGCCCGGTTTCACCATGTTGG + Intronic
1031836294 7:126685233-126685255 TTGGCCCGGCCCCATCATGGTGG - Intronic
1033657072 7:143381556-143381578 GCAGCCCGGCCCGGCCATGGCGG + Exonic
1036645538 8:10609639-10609661 GCCGCCCGGAGCCACCATGATGG - Exonic
1037450694 8:19013712-19013734 GCGGCCCGCGCGCACCCTGGCGG + Intronic
1047216501 8:122880335-122880357 GAGTCCCAGCCCCACCATGGTGG - Intronic
1062173929 9:135150519-135150541 GCAGCCTGGACCCACCATGTGGG - Intergenic
1062185476 9:135216021-135216043 GCGACCAGGACCCACCAAGGTGG - Intergenic
1062416158 9:136451353-136451375 TCGGCACGATCCCACCCTGGGGG + Exonic
1200121888 X:153794980-153795002 GGGGGCCGGGCGCACCATGGAGG - Intronic