ID: 1118594009

View in Genome Browser
Species Human (GRCh38)
Location 14:67422124-67422146
Sequence CCCTGGGTGTATAGGCCAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1118594009_1118594022 30 Left 1118594009 14:67422124-67422146 CCATCTGGCCTATACACCCAGGG No data
Right 1118594022 14:67422177-67422199 GGCAAGGTATCAGGCAACTAGGG No data
1118594009_1118594017 14 Left 1118594009 14:67422124-67422146 CCATCTGGCCTATACACCCAGGG No data
Right 1118594017 14:67422161-67422183 ATCTTAATCATCCCAGGGCAAGG No data
1118594009_1118594021 29 Left 1118594009 14:67422124-67422146 CCATCTGGCCTATACACCCAGGG No data
Right 1118594021 14:67422176-67422198 GGGCAAGGTATCAGGCAACTAGG No data
1118594009_1118594014 8 Left 1118594009 14:67422124-67422146 CCATCTGGCCTATACACCCAGGG No data
Right 1118594014 14:67422155-67422177 TTCCTCATCTTAATCATCCCAGG No data
1118594009_1118594018 21 Left 1118594009 14:67422124-67422146 CCATCTGGCCTATACACCCAGGG No data
Right 1118594018 14:67422168-67422190 TCATCCCAGGGCAAGGTATCAGG No data
1118594009_1118594015 9 Left 1118594009 14:67422124-67422146 CCATCTGGCCTATACACCCAGGG No data
Right 1118594015 14:67422156-67422178 TCCTCATCTTAATCATCCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1118594009 Original CRISPR CCCTGGGTGTATAGGCCAGA TGG (reversed) Intergenic
No off target data available for this crispr